Encoding gene of green fluorescent protein nanobody and its preparation method and application

A green fluorescent protein and nanobody technology, applied in the field of genetic engineering, can solve the problems of high production cost, affecting the application of GFP antibody, poor stability, etc., achieving high specificity and affinity, convenient for biochemical labeling, and easy to penetrate cells. organizational effect

Active Publication Date: 2021-09-24
SUN YAT SEN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Traditional GFP antibodies are obtained by immunizing animals, which often have problems of poor stability and high production costs, which affect the application of GFP antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding gene of green fluorescent protein nanobody and its preparation method and application
  • Encoding gene of green fluorescent protein nanobody and its preparation method and application
  • Encoding gene of green fluorescent protein nanobody and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1: Construction of GFP Nanobody Library

[0078] (1) Prokaryotic expression of purified GFP, dilute the concentration to 1mg / mL, mix 1mg GFP with an equal volume of adjuvant (purchased from GERBU) for each immunization, and immunize an alpaca once every two weeks for a total of 5 Second-rate.

[0079] (2) After the 5 times of immunization, 50 mL of alpaca peripheral blood was drawn, blood lymphocytes were separated by dextran-diatrizoate meglumine density gradient centrifugation, and total cellular RNA was extracted by Trizol method.

[0080] (3) According to TAKARA's PrimerScript TM 1st Strand cDNA Synthesis Kit manual, the extracted RNA is reverse-transcribed into cDNA, and the variable region (VHH region) of the alpaca heavy chain antibody is amplified by nested PCR.

[0081] The first round of PCR: perform 8 parallel PCRs, the primers used are as follows:

[0082] Upstream primer (5'-3'): GTCCTGGCTGCTCTTCTACAAGG,

[0083] Downstream primer (5'-3'): GG...

Embodiment 2

[0102] Example 2: Enrichment process of GFP-specific Nanobodies

[0103] (1) According to EZ-LinkTM Sulfo-NHS-LC-Biotinylation Kit (purchased from Thermo FisherScientific TM company), the purified GFP was coupled to biotin (biotin).

[0104] (2) Take 1 μg of biotin-coupled GFP and 30 μL of streptavidin-coupled magnetic beads (Dynabeads TM M-280 Streptavidin, Invitrogen) were incubated at room temperature for 30 min to bind GFP to the magnetic beads, and then washed 3 times with PBST to wash away unbound GFP.

[0105] (3) Add 500 μL phage display library (containing 5×10 12 A phage displaying the immune alpaca nanobody), and incubated at room temperature for 2h. Wash 25 times with PBST to wash away unbound or weakly binding phages. The phage specifically bound to GFP was dissociated with 500 μL trypsin (0.25 mg / mL), and 10 μL protease inhibitor cocktail (50x) (purchased from Roche Company) was added to the dissociated phage solution for neutralization.

[0106] (4) Take ...

Embodiment 3

[0111] Example 3: Enzyme-linked immunosorbent assay (ELISA) screening of GFP-specific nanobody positive monoclonal

[0112] (1) Randomly select 20 bacterial single clones from the overnight cultured nanobody bacterial library obtained after the third round of screening in Example 2, inoculate them into LB medium respectively, cultivate to the logarithmic phase of bacterial growth, and add the final concentration 0.2mM IPTG, incubated overnight at 30°C to induce the expression of nanobodies.

[0113] (2) The bacteria were collected the next day, and CelLytic was used to TM B Cell Lysis Reagent (purchased from Sigma Company) was used to lyse the bacteria to obtain the nanobody crude extract. Take 100 μL of antibody crude extract, add it to the ELISA plate coated with GFP and blocked with 3% BSA, and incubate at room temperature for 1 hour.

[0114] (3) Wash 5 times with PBST, 1 min each time, to wash away unbound protein. Anti-pIII antibody (1:1000, purchased from NEB Compa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to four green fluorescent protein (GFP) nanobody coding genes, a preparation method and application thereof. The present invention constructs a GFP nanobody library. Using phage display technology, four nanobodies specifically binding to GFP were screened from the antibody library, named A12, E6, D5 and B9, respectively. Sequencing obtained the nucleotide sequences of these four Nanobody genes, as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, and their corresponding amino acid sequences are shown in SEQ ID Shown in NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8. The A12 gene was cloned into the transformed expression vector pADL-10b-His, and introduced into the SS320 strain; the E6, D5 and B9 genes were respectively cloned into the transformed expression vector pBAD24-Flag-His, and introduced into the TOP10 strain respectively, Thus, prokaryotic expression vectors and bacterial strains of four nanobodies were obtained. The present invention expresses and purifies four nanobodies and proves that the four GFP nanobodies can specifically bind GFP, and can be applied to the detection of GFP in basic research.

Description

technical field [0001] The invention relates to a coding gene of a nanobody, a preparation method and application thereof, and belongs to the field of genetic engineering, in particular to four kinds of coding genes of green fluorescent protein nanobodies, a preparation method and an application thereof. Background technique [0002] Green fluorescent protein (GFP) is a fluorescent molecule with a size of about 27KDa, which can emit green light when excited by blue wavelength light. GFP is widely used as a protein label in the field of basic biomedical research. It is expressed by fusion with the target protein to observe the localization and molecular movement of the target protein. Therefore, GFP antibodies are in great demand in basic research. [0003] At present, the most widely used antibody is a tetramer composed of two heavy chains and two light chains, with a size of about 150KDa, called traditional antibody. Traditional antibodies have high specificity and affini...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/13C12N15/70C12N1/21C07K16/18
CPCC07K16/18C07K2317/33C07K2317/569
Inventor容益康裘建香李凯丽
OwnerSUN YAT SEN UNIV