Application of insect DNA transmethylase Dnmt1 to pest control
A methyltransferase, pest control technology, applied in recombinant DNA technology, DNA/RNA fragments, applications, etc., can solve the problems of low binding efficiency and other problems, and achieve increased larval mortality, delayed worm growth, and reduced feeding. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 BmDnmt1 The phenotype of the silkworm whose expression was suppressed
[0027] 1) silkworm Dnmt1 dsRNA vector construction
[0028] Bombyx mori were synthesized according to the instructions of the kit T7 RiboMAX™ Express RNAi System (purchased from Promega) Dnmt1 The dsRNA sequence (SEQ ID NO: 1), GFP The dsRNA sequences (SEQ ID NO: 2) were used to construct the silkworm Dnmt1 The dsRNA carrier and the blank control carrier are used for subsequent RNAi interference experiments.
[0029] The silkworm mentioned above Dnmt1 dsRNA sequence (SEQ ID NO: 1):
[0030] 5’-AUCAAGCUGGAGUUGCAGAAUGCAAGUGGGCUAUUGAAAACGUGGAAGCUGCUUCUCAUGCUUAUUCAUUAAAUAAUAAAAGUUGUAUUGUAUUUAAUGAAGACUGUAAUGCACUUUUGAAAACUGUAAUGUCUGGUGCUAAGCACAGCGCGAAUGGACUGCGGCUCCCCAUGCAAGGAGAAGUGGAGCUUUUAUGUGGCGGGCCACCAUGUCAAGGCUUCUCCGGAAUGAAUCGUUUUAAUUCAAGAGAGUAUUCAAACUUCAAAAACUCAUUAGUUGCAUCGUAUUUAUCGUUUUGUGAUUAUUACAGACCUAAAUAUUUUAUACUGGAAAACGUUCGUAACUUUGUGGCCUUUAA-3’(SEQ ID NO:1)。
[0031] GF...
Embodiment 2
[0045] Example 2 Dnmt1 Phenotypes of Spodoptera litura with suppressed expression
[0046] 1) Spodoptera litura Dnmt1 sequence acquisition
[0047] From our unpublished database of expression in the midgut of Spodoptera litura feeding on mustard greens, Spodoptera litura Dnmt1 The cDNA sequence was obtained by PCR and verified by sequencing. Spodoptera litura Dnmt1 The ORF sequence is (SEQ ID NO: 3):
[0048]5’-ATGGATGAATATATAGAAACTAAACACCTACTAGATATTGAAATGGATGAATATATAGAAACTAAACACCAACTAGATATTAAAATGGATGAAAATGAAAACAATAATGTTATAGCGAAAACAAAACCAATTGTTCTTGACAATGAGAAATGTGAAACCTGTGGCCAATTTCTCAATAATTCAGATATAATTTTCTATCAAGGACACCCACAGAATTCAGTGGAAGAGTATATAGCATTGACTAATGAGAAACTTGTTCTAGCATCAGGTGAAGAGGGTGATATAATGGAAAGACCACAAACCAATATAACCAGTTTCTGTATATTTGACGAGCAAGGCCACCTGGTACCAATTGATGGTGGTCTTGTTGAAAACGATGTGTGTATTTATATGTCAGGATACTTGAAGTCAATATGCACAGATTCACCGGAAATTGATGATGAATCGGTCCCTGTGAAAGATGTAGGCCCTATTATTGAATGGTTCATACATGGCTTTGACGGTGGTGAGAAAAACTGTATCACATTATCAACAGAATTTGGAGAATATAATTTATTGAAACCAAGTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



