Method for preparing O type foot-and-mouth disease virus-like particles and test paper
A foot-and-mouth disease virus and foot-and-mouth disease technology, which is applied in the field of serological detection, can solve the problems of being easily interfered by the external environment, high requirements for testing personnel, and long testing period, so as to avoid large-scale outbreaks, low testing conditions, and high accuracy. high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The present invention will be described in further detail below in conjunction with the accompanying drawings and embodiments.
[0031] The embodiment of the present invention provides a method for preparing O-type foot-and-mouth disease virus-like particles, comprising the following steps:
[0032] S1. Construction of small ubiquitin-like modified protein fusion expression vector pSM:
[0033] a. The smt3 gene was amplified from the genome of Saccharomyces cerevisiae strain EGY48 (GenBank accession number: AY558174), and the primer sequence was as follows: upstream primer smt3F: 5'GCCATGGGTCATCACCATCATCATCATCAC(6×His)GGGTCGGACTCAGAAGTCAATCAA 3'; downstream primer smt3F: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3'.
[0034] b. Insert the smt3 gene into the pET-28a vector treated with the same endonuclease after double digestion with Nco I (restriction endonuclease) and BamH I (a restriction endonuclease), the resulting vector For pSM1, the kanamycin resistance g...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com