Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for preparing O type foot-and-mouth disease virus-like particles and test paper

A foot-and-mouth disease virus and foot-and-mouth disease technology, which is applied in the field of serological detection, can solve the problems of being easily interfered by the external environment, high requirements for testing personnel, and long testing period, so as to avoid large-scale outbreaks, low testing conditions, and high accuracy. high effect

Inactive Publication Date: 2017-05-31
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the detection methods of O-type FMD antibody mainly include CFT (complement fixation test), VNT (human vitronectin), agglutination test, immunodiffusion and ELISA (enzyme-linked immunosorbent assay), etc., but these methods are easily affected by the external environment. Interference, need to be tested in a laboratory with stable conditions
[0006] The most commonly used method for detecting FMDV (foot and mouth disease virus, foot and mouth disease virus) is the ELISA method, but this method needs to purify the blood sample in advance, and needs to go through more complicated operations under external conditions such as specific temperature The detection can only be completed with the use of more detection equipment, the detection period is long, and the requirements for the detection personnel are high, so it is impossible to perform real-time and rapid measurement on the spot

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing O type foot-and-mouth disease virus-like particles and test paper

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The present invention will be described in further detail below in conjunction with the accompanying drawings and embodiments.

[0031] The embodiment of the present invention provides a method for preparing O-type foot-and-mouth disease virus-like particles, comprising the following steps:

[0032] S1. Construction of small ubiquitin-like modified protein fusion expression vector pSM:

[0033] a. The smt3 gene was amplified from the genome of Saccharomyces cerevisiae strain EGY48 (GenBank accession number: AY558174), and the primer sequence was as follows: upstream primer smt3F: 5'GCCATGGGTCATCACCATCATCATCATCAC(6×His)GGGTCGGACTCAGAAGTCAATCAA 3'; downstream primer smt3F: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3'.

[0034] b. Insert the smt3 gene into the pET-28a vector treated with the same endonuclease after double digestion with Nco I (restriction endonuclease) and BamH I (a restriction endonuclease), the resulting vector For pSM1, the kanamycin resistance g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing O type foot-and-mouth disease virus-like particles and test paper, and relates to the technical field of serological testing. The method comprises the steps of constructing a small ubiquitin-like modifier fusion expression vector pSM, and recombinant expression vectors pSM1 / VP0, pSM2 / VP3 and pSM1 / VP1, constructing a double expression recombinant vector pSM1 / VP0-VP1, expressing and purifying protein, and conducting in-vitro assembly of the O type foot-and-mouth disease virus-like particles. The test paper comprises a base board. A detection layer is arranged on the top of the base board and comprises a detection line and a control line. An absorption layer is arranged on the side, near the control line, of the top of the detection layer. An immune-gold localization pad is arranged on the side, near the detection line, of the top of the detection layer, and a sample pad is arranged on the top of the immune-gold localization pad. The immune-gold localization pad is coated with colloidal gold particles. SPA markers are combined with the colloidal gold particles. The detection line is coated / infiltrated with A type foot-and-mouth disease virus-like particles, and the control line is coated / infiltrated with rabbit IgG. In this way, the detection period can be shortened, and real-time quick detection can be achieved on site.

Description

technical field [0001] The invention relates to the technical field of serological detection, in particular to a method for preparing O-type foot-and-mouth disease virus-like particles and a detection test paper. Background technique [0002] Foot-and-Mouth disease (FMD) is an acute, febrile, highly contagious animal disease that can spread quickly and over long distances caused by foot-and-mouth disease virus. FMD has a wide range of hosts, including domestic ruminants, deer and pigs, and more than 70 wild artiodactyls. The World Organization for Animal Health (OIE) lists it as the first class A infectious disease. Once foot-and-mouth disease breaks out, it will often spread on a large scale, and it is not easy to control and eliminate, which will bring serious economic losses to the animal husbandry in the disease-endemic countries and regions. [0003] Therefore, the World Organization for Animal Health (OIE) ranks the disease at the top of the 15 Class A animal diseases...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/04C12N15/70G01N33/569G01N33/558
Inventor 孙世琪郭慧琛张韵常艳燕魏衍全茹嘉喜智晓莹杜平刘湘涛殷宏罗建勋
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More