Aptamer for detecting human renal clear cell carcinoma cells and application of aptamer in preparing detection preparation

A technology of clear cells and nucleic acid aptamers, applied in measuring devices, biochemical equipment and methods, instruments, etc., can solve the problems of lack of early recognition or judgment of symptoms, no targeted therapy of renal cancer cells, insensitivity to radiotherapy and chemotherapy, etc. Achieve high affinity and specificity, short cycle time, and good reproducibility

Active Publication Date: 2017-05-31
HUNAN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are many problems in the identification and treatment of kidney cancer, such as the lack of symptoms for early recognition or judgment; insensitivity to radiotherapy and chemotherapy, but immunotherapy has a certain effect; there are currently some targeted therapies for anti-angiogenesis, but they are not specific Targeted therapy for kidney cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer for detecting human renal clear cell carcinoma cells and application of aptamer in preparing detection preparation
  • Aptamer for detecting human renal clear cell carcinoma cells and application of aptamer in preparing detection preparation
  • Aptamer for detecting human renal clear cell carcinoma cells and application of aptamer in preparing detection preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Determination of the sequence with the strongest specific binding ability to the 786-O cell line

[0027] First, digest the 786-O cells in the adherent state from the culture dish with 0.2% EDTA, collect the cells into centrifuge tubes, and wash them by centrifugation with washing buffer (PBS, containing 0.45% glucose, 5 mM magnesium chloride) several times; secondly, all the sequences in the Swan Library with a final concentration of 250nM were added to the 786- O cells; then placed on a shaker at 4°C and incubated for 60 min; after the incubation was completed, they were centrifuged and washed twice with washing buffer (PBS, containing 0.45% glucose, 5 mM magnesium chloride), and fluorescence detection was performed by flow cytometry ( see results figure 1 ). The detection results are shown in the figure, the sequence with the largest displacement is the sequence with the strongest binding ability to 786-O cells, and we named it RCC-H1.

Embodiment 2

[0028] Embodiment 2: RCC-H1 specifically recognizes renal clear cell carcinoma cell 786-O

[0029] This experiment has similarities with some processing steps in Example 1. First, 786-O and KFB in the adherent state were digested from the culture dish with 0.2% EDTA, respectively, and the cells were collected into centrifuge tubes, and washed with washing buffer (PBS, containing 0.45% glucose, 5 mM magnesium chloride) Centrifuge and wash several times; add an equal amount of binding buffer (D-PBS, containing 0.45% glucose, 5 mM magnesium chloride, 100mg / L tRNA, 1g / L BSA) to 786-O and KFB respectively, and put into the final RCC-H1 and the control sequence at a concentration of 250nM; then placed on a shaker at 4°C and incubated for 60min; after the incubation was completed, they were centrifuged and washed twice with washing buffer (PBS, containing 0.45% glucose, 5 mM magnesium chloride), and passed through flow cytometry Cytometer for fluorescence detection (results see fi...

Embodiment 3

[0030] Embodiment 3: RCC-H1 sequence adds the deletion method of the primer complete sequence of both sides

[0031] Since we don't know which sequence in the whole sequence has a strong combination with 786-O, we optimize the sequence through the following deletion method:

[0032] (The underlined part is the conserved nucleotide sequence of RCC-H1)

[0033] The RCC-H1 sequence plus the full sequence of the primers on both sides is:

[0034] ACCGACCGTGCTGGACTCA TAGGGTTAGGGGCTGCTGGCCAGATATTCAGATGGTAGGGTT ACTATGAGCGAGCCTGGCG (SEQ ID NO. 1)

[0035] RCC-H1a: (Delete 5 bases in the left primer region, delete 4 bases in the right primer region)

[0036] CCGTGCTGGACTCA TAGGGTTAGGGGCTGCTGGCCAGATATTCAGATGGTAGGGTTACTATGAGCGAGCCT (SEQ ID NO. 2)

[0037] RCC-H1b: (Delete 15 bases in the left primer region, delete 11 bases in the right primer region)

[0038] ACTCA TAGGGTTAGGGGCTGCTGGCCAGATATTCAGATGGTAGGGTT ACTATGA (SEQ ID NO. 3)

[0039] RCC-H1c: (Delete 19 bases in the left pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an aptamer for detecting human renal clear cell carcinoma cells (786-O) and application of the aptamer in a preparing detection preparation. Compared with the prior art, the aptamer has affinity and specificity higher than those of an associated protein antibody, is free of immunogenicity, can be chemically synthesized in vitro and is small in molecular weight. Furthermore, different parts of the aptamer can be modified and replaced, so that sequences are stable, storage is convenient, and labeling is convenient. When the aptamer disclosed by the invention is adopted to detect the human renal clear cell carcinoma cells, operations are simpler and quicker; and moreover, synthesis cost of the aptamer is lower than preparation cost of the antibody, the period is short and repeatability is good.

Description

technical field [0001] The present invention relates to a nucleic acid aptamer and its application, in particular to a nucleic acid aptamer which can be used for the detection of human renal clear cell carcinoma cells and clinical sample tissues and its use in the preparation of detection reagents. Background technique [0002] Renal cancer is a malignant tumor originating from the urinary tubular epithelial system of the renal parenchyma. Due to the extension of average life expectancy and the advancement of medical imaging, the incidence of renal cancer has increased compared to before, and the incidence of renal cancer with no obvious clinical symptoms but accidentally discovered during physical examination is increasing day by day, reaching 50% to 70%. Kidney cancer includes various subtypes of renal cell carcinoma that originate in different parts of the urinary tubule. [0003] Renal cancer is divided into many types, among which clear cell renal carcinoma (convention...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115G01N33/574
CPCC12N15/115C12N2310/16G01N33/57438
Inventor叶茂谭蔚泓胡小晓张慧
OwnerHUNAN UNIV