Primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR, and preparation method thereof

Abstract

The invention discloses a primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR. The primer group comprises the following primers: T790M-F: CTCCACCGTGCAGCTCATCTT; T790M-R: TGCACACACCAGTTGAGCAGGT; and TaqMan-MGB probe 1: TCGGCTGCCTCCTGGA, wherein the T790M-R is a wild type downstream primer, and the upstream primer T790M-F is an ARMS primer. A mismatched base T is additionally introduced at the second position of a 3'end, so that a wild type template has two mismatched bases, and the amplification efficiency is remarkably reduced; and a T790M mutation template has only one mismatched base which is not at the 3' tail end, and specific amplification still can be conducted, so that the T790M mutation lower than 1 percent in 5 ng of a sample can be detected sensitively. The invention also discloses preparation methods of the primers and the probe. The primer group has the beneficial effects: (1) the specificity is high; (1) the quick and efficient amplification is realized; (3) the sensitivity is high; (4) the simple and convenient authentication is realized; and (5) the application is wide.

Description

technical field [0001] The invention belongs to the fields of molecular diagnosis and gene diagnosis, and relates to a primer set for detecting EGFR gene T790M mutation in non-small cell lung cancer patient samples based on ARMS fluorescence quantitative PCR and a preparation method thereof. Background technique [0002] Non-small cell lung cancer (NSCLC) is a common malignant tumor that seriously endangers human health. In recent years, epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) has been widely used in the treatment of NSCLC patients. [0003] EGFR-TKI can effectively delay the progression of advanced NSCLC and prolong the survival of patients. The efficacy of EGFR-TKI largely depends on the mutation status of EGFR. Early clinical studies have shown that female, Asian, non-smoking or less smoking, NSCLC patients with adenocarcinoma have a higher response rate to Gefitinib. It was subsequently found that EGFR mutations were significantly correla...

AI Technical Summary

Problems solved by technology

When designing ARMS primers, the 3' end is designed at the mutation site, and the last base is paired with the mutation base. Only when the 3' end of the primer is completely paired can it be amplified normally. When there is a mismatch at the 3' end of the primer, it will not be effective. amplify

Images