Primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR, and preparation method thereof

A T790M, T790M-F technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve problems such as ineffective amplification, and achieve a wide range of applications, efficient amplification, and high sensitivity. Effect

Inactive Publication Date: 2017-05-31
SHANGHAI PERSONAL BIOTECH
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When designing ARMS primers, the 3' end is designed at the mutation site, and the last base is paired with the mutation base. Only when the 3' end of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR, and preparation method thereof
  • Primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR, and preparation method thereof
  • Primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR, and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. T790M-F: CTCCACCGTGCAGCTCATCTT

[0038] 2. T790M-R: TGCACACACCAGTTGAGCAGGT

[0039] 3. TaqMan-MGB probe 1: TCGGCTGCCTCCTGGA

[0040] 4. E28-F:CGAGTATCTCAACACTGTCCAGC

[0041] 5. E28-R:GAAAGAAGTCCTGCTGGTAGTCAG

[0042] 6. TaqMan-MGB probe 2: CATTCGACAGCCCTGC

[0043] The above primers and probes were synthesized by the solid-phase phosphoramidite triester method. Specific steps are as follows:

[0044] 1) Using trichloroacetic acid to remove the protecting group DMT of the 5'-hydroxyl group of the solid-phase carrier to obtain a free 5'-hydroxyl group;

[0045] 2) mixing the phosphoramidite-protected nucleotide monomer with the activator tetrazolium to obtain a nucleoside phosphorous acid activated intermediate, which undergoes a condensation reaction with the free 5'-hydroxyl group;

[0046] 3) Since there is no guarantee that 100% of the 5'-hydroxyl groups will participate in the condensation, there may be a very small number of 5'-hydroxyl groups that have no...

Embodiment 2

[0050] Example 2: Fluorescence quantitative PCR rapid detection of EGFR gene T790M point mutation

[0051] Step 1: Pretreatment of the sample to be inspected

[0052] Sample DNA was extracted according to conventional methods.

[0053] The samples are as follows:

[0054] Sample 1: Sterile double distilled water with DNAase removed

[0055] Sample 2: A sample without the EGFR gene T790M mutation

[0056] Sample 3: cfDNA standard with 1% T790M mutation frequency

[0057] Sample 4: cfDNA standard with 5% T790M mutation frequency

[0058] Step 2: Real-time quantitative PCR reaction system configuration

[0059] Fluorescent quantitative PCR reaction system (20μL):

[0060]

[0061] The T790M detection reaction and the internal reference E28 reaction are divided into 2 tubes. These 2 reactions were performed for each sample.

[0062] Step 3: Real-time quantitative PCR reaction is carried out

[0063] React the reaction solution prepared in step 2 in the Stepone Plus flu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR. The primer group comprises the following primers: T790M-F: CTCCACCGTGCAGCTCATCTT; T790M-R: TGCACACACCAGTTGAGCAGGT; and TaqMan-MGB probe 1: TCGGCTGCCTCCTGGA, wherein the T790M-R is a wild type downstream primer, and the upstream primer T790M-F is an ARMS primer. A mismatched base T is additionally introduced at the second position of a 3'end, so that a wild type template has two mismatched bases, and the amplification efficiency is remarkably reduced; and a T790M mutation template has only one mismatched base which is not at the 3' tail end, and specific amplification still can be conducted, so that the T790M mutation lower than 1 percent in 5 ng of a sample can be detected sensitively. The invention also discloses preparation methods of the primers and the probe. The primer group has the beneficial effects: (1) the specificity is high; (1) the quick and efficient amplification is realized; (3) the sensitivity is high; (4) the simple and convenient authentication is realized; and (5) the application is wide.

Description

technical field [0001] The invention belongs to the fields of molecular diagnosis and gene diagnosis, and relates to a primer set for detecting EGFR gene T790M mutation in non-small cell lung cancer patient samples based on ARMS fluorescence quantitative PCR and a preparation method thereof. Background technique [0002] Non-small cell lung cancer (NSCLC) is a common malignant tumor that seriously endangers human health. In recent years, epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) has been widely used in the treatment of NSCLC patients. [0003] EGFR-TKI can effectively delay the progression of advanced NSCLC and prolong the survival of patients. The efficacy of EGFR-TKI largely depends on the mutation status of EGFR. Early clinical studies have shown that female, Asian, non-smoking or less smoking, NSCLC patients with adenocarcinoma have a higher response rate to Gefitinib. It was subsequently found that EGFR mutations were significantly correla...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/156
Inventor 汪元涛朱月艳孙子奎
Owner SHANGHAI PERSONAL BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap