Primer group for detecting EGFR (epidermal growth factorreceptor) gene T790M mutation based on ARMS fluorescent quantitative PCR, and preparation method thereof
A T790M, T790M-F technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve problems such as ineffective amplification, and achieve a wide range of applications, efficient amplification, and high sensitivity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1. T790M-F: CTCCACCGTGCAGCTCATCTT
[0038] 2. T790M-R: TGCACACACCAGTTGAGCAGGT
[0039] 3. TaqMan-MGB probe 1: TCGGCTGCCTCCTGGA
[0040] 4. E28-F:CGAGTATCTCAACACTGTCCAGC
[0041] 5. E28-R:GAAAGAAGTCCTGCTGGTAGTCAG
[0042] 6. TaqMan-MGB probe 2: CATTCGACAGCCCTGC
[0043] The above primers and probes were synthesized by the solid-phase phosphoramidite triester method. Specific steps are as follows:
[0044] 1) Using trichloroacetic acid to remove the protecting group DMT of the 5'-hydroxyl group of the solid-phase carrier to obtain a free 5'-hydroxyl group;
[0045] 2) mixing the phosphoramidite-protected nucleotide monomer with the activator tetrazolium to obtain a nucleoside phosphorous acid activated intermediate, which undergoes a condensation reaction with the free 5'-hydroxyl group;
[0046] 3) Since there is no guarantee that 100% of the 5'-hydroxyl groups will participate in the condensation, there may be a very small number of 5'-hydroxyl groups that have no...
Embodiment 2
[0050] Example 2: Fluorescence quantitative PCR rapid detection of EGFR gene T790M point mutation
[0051] Step 1: Pretreatment of the sample to be inspected
[0052] Sample DNA was extracted according to conventional methods.
[0053] The samples are as follows:
[0054] Sample 1: Sterile double distilled water with DNAase removed
[0055] Sample 2: A sample without the EGFR gene T790M mutation
[0056] Sample 3: cfDNA standard with 1% T790M mutation frequency
[0057] Sample 4: cfDNA standard with 5% T790M mutation frequency
[0058] Step 2: Real-time quantitative PCR reaction system configuration
[0059] Fluorescent quantitative PCR reaction system (20μL):
[0060]
[0061] The T790M detection reaction and the internal reference E28 reaction are divided into 2 tubes. These 2 reactions were performed for each sample.
[0062] Step 3: Real-time quantitative PCR reaction is carried out
[0063] React the reaction solution prepared in step 2 in the Stepone Plus flu...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com