Using wheat genes to improve don and fhb resistance in Arabidopsis
A kind of Arabidopsis thaliana gene technology, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problem of no MetRS gene, etc., and achieve the effect of improving scab resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Isolation and cloning of the full-length sequence of the TaMetRS gene.
[0032] From the suppression subtractive hybridization library (SSH) of the suspension cells of wheat, the EST fragment of 390bp is obtained by screening, which is strongly induced by DON (applicant's previous work, unpublished), and the sequence is as follows:
[0033]AAAAGATGTCTTGCAACAGCTGAATCTCTGTCCGAATGAGCATATTTCTTTTGCCGATGAAAAGGGGGAGAGTGACAAGGCGAAAAGGCCTTGGGATCTTATACCATCAAACCACAGGATTGGGAAAATTGTGCCTTTGTTCACAGAGTTGAAAGATGATGCAGTGGATAGCTTCAGGGAAACATTTGCAGGCAGTCAGGCCGAAAGAAACGCAAGGGCTAATTAAAGAAGCCAATGAAGTTGTTGCCTAACTGGAAGCTGCAAAACATTTCTTGCAAAGTTGATCACAATACTTAATCAAATGACATTGAGATCCAGAAATGTGAGTTCGAAGGATGAATCACAATGTATATTTTACTGATTATTAGTGATGATGCATTCAGAAAATGT
[0034] According to the sequence, the applicant designed two upstream primers and two downstream primers, respectively: 3'RACE-F1 / 3'RACE-F2 and 5'RACE-R1 / 5'RACE-R2 (see Table 1), According to the instructions of the RACE kit (purchased fr...
Embodiment 2
[0039] Example 2: Detection of the expression pattern of the TaMetRS gene in wheat varieties
[0040] The applicant selected two wheat varieties, Zhengmai 9023 (susceptible to FHB, nationally approved variety, nationally approved wheat 2003027, see Cheng et al., Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and a fungal chitinase protects wheatagainst Fusarium pathogens and mycotoxins.Plant BiotechnologyJournal.2015.doi:10.1111 / pbi.12289) and Sumai No. 3 (resistance to FHB, bred by Jiangsu Agricultural Science Institute in 1970, highly resistant to scab, See Cheng et al., Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.Plant Biotechnology Journal.2015.doi:10.1111 / pbi.12289), as expression profile analysis s material. After germination, the seeds were placed in a refrigerator ...
Embodiment 3
[0041] Example 3: Construction and Transformation of TaMetRS Gene Overexpression Vector Arabidopsis
[0042] Construction of PTRAkc-35SS-TaMetRS Plant Expression Vector
[0043] In order to better analyze the function of the TaMetRS gene, the applicant overexpressed the TaMetRS gene in Arabidopsis. The function of the gene was studied from the phenotype of transgenic plants. The method for constructing the overexpression vector is as follows: use the cDNA obtained by reverse transcription of the total RNA after 12 h treatment of wheat variety Zhengmai 9023 (Z9) DON as a template, and use primers TaMetRS-F2 / TaMetRS-R2 (see Table 1) to amplify A cDNA fragment comprising the complete coding region of the TaMetRS gene (see the sequence shown in SEQ ID NO: 1 in the sequence table) was added, and EcoRI and BamHI restriction sites were added to the two ends of the cDNA fragment respectively. The reaction conditions were: 94°C pre- Denaturation for 5min; 35 cycles of 94°C for 30sec,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



