Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Using wheat genes to improve don and fhb resistance in Arabidopsis

A kind of Arabidopsis thaliana gene technology, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problem of no MetRS gene, etc., and achieve the effect of improving scab resistance

Active Publication Date: 2020-05-29
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no related report about MetRS gene and DON resistance and FHB resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Using wheat genes to improve don and fhb resistance in Arabidopsis
  • Using wheat genes to improve don and fhb resistance in Arabidopsis
  • Using wheat genes to improve don and fhb resistance in Arabidopsis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Isolation and cloning of the full-length sequence of the TaMetRS gene.

[0032] From the suppression subtractive hybridization library (SSH) of the suspension cells of wheat, the EST fragment of 390bp is obtained by screening, which is strongly induced by DON (applicant's previous work, unpublished), and the sequence is as follows:

[0033]AAAAGATGTCTTGCAACAGCTGAATCTCTGTCCGAATGAGCATATTTCTTTTGCCGATGAAAAGGGGGAGAGTGACAAGGCGAAAAGGCCTTGGGATCTTATACCATCAAACCACAGGATTGGGAAAATTGTGCCTTTGTTCACAGAGTTGAAAGATGATGCAGTGGATAGCTTCAGGGAAACATTTGCAGGCAGTCAGGCCGAAAGAAACGCAAGGGCTAATTAAAGAAGCCAATGAAGTTGTTGCCTAACTGGAAGCTGCAAAACATTTCTTGCAAAGTTGATCACAATACTTAATCAAATGACATTGAGATCCAGAAATGTGAGTTCGAAGGATGAATCACAATGTATATTTTACTGATTATTAGTGATGATGCATTCAGAAAATGT

[0034] According to the sequence, the applicant designed two upstream primers and two downstream primers, respectively: 3'RACE-F1 / 3'RACE-F2 and 5'RACE-R1 / 5'RACE-R2 (see Table 1), According to the instructions of the RACE kit (purchased fr...

Embodiment 2

[0039] Example 2: Detection of the expression pattern of the TaMetRS gene in wheat varieties

[0040] The applicant selected two wheat varieties, Zhengmai 9023 (susceptible to FHB, nationally approved variety, nationally approved wheat 2003027, see Cheng et al., Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and a fungal chitinase protects wheatagainst Fusarium pathogens and mycotoxins.Plant BiotechnologyJournal.2015.doi:10.1111 / pbi.12289) and Sumai No. 3 (resistance to FHB, bred by Jiangsu Agricultural Science Institute in 1970, highly resistant to scab, See Cheng et al., Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.Plant Biotechnology Journal.2015.doi:10.1111 / pbi.12289), as expression profile analysis s material. After germination, the seeds were placed in a refrigerator ...

Embodiment 3

[0041] Example 3: Construction and Transformation of TaMetRS Gene Overexpression Vector Arabidopsis

[0042] Construction of PTRAkc-35SS-TaMetRS Plant Expression Vector

[0043] In order to better analyze the function of the TaMetRS gene, the applicant overexpressed the TaMetRS gene in Arabidopsis. The function of the gene was studied from the phenotype of transgenic plants. The method for constructing the overexpression vector is as follows: use the cDNA obtained by reverse transcription of the total RNA after 12 h treatment of wheat variety Zhengmai 9023 (Z9) DON as a template, and use primers TaMetRS-F2 / TaMetRS-R2 (see Table 1) to amplify A cDNA fragment comprising the complete coding region of the TaMetRS gene (see the sequence shown in SEQ ID NO: 1 in the sequence table) was added, and EcoRI and BamHI restriction sites were added to the two ends of the cDNA fragment respectively. The reaction conditions were: 94°C pre- Denaturation for 5min; 35 cycles of 94°C for 30sec,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant gene engineering, and in particular relates to improvement of DON (deoxynivalenol) resistance and FHB (fusarium head blight) resistance of arabidopsis by utilizing wheat genes. A gene TaMetRS which is capable of improving DON resistance and gibberellic disease resistance of arabidopsis can be obtained through separation. By utilizing a method of screening a wheat suspension cell suppression subtractive hybridization cDNA (complementary deoxyribonucleic acid) library and full length of RACE (rapid-amplification of complementary deoxyribonucleic acid ends) clone genes, a gene TaMetRS which is not induced by DON can be separated from a wheat variety. By utiizing an agrobacterium tumefaciens mediated genetic transformation method, the gene is excessively expressed in arabidopsis, the resistance of the transgenic arabidopsis to the DON and the gibberellic diseases can be improved, and tests demonstrate novel application of the gene with a plant gibberellic disease resistance function. The nucleotide sequence of the gene is a sequence corresponding to a base at a site 1-2186 in SEQID NO:1, and 596 amino acids are encoded. The protein sequence encoded by the gene is as shown in SEQ ID NO:2.

Description

technical field [0001] The invention belongs to the field of wheat transgenic technology. Specifically related to the use of wheat genes to enhance DON tolerance and FHB resistance in Arabidopsis. Said gene is separated and cloned from TaMetRS gene, which is proved to be a MetRS gene with new functions, and plays an important role in plant defense response and detoxification process. The TaMetRS gene is induced by DON, localizes in the nucleus, and participates in the regulation of cellular defense responses. Overexpression of this gene can improve DON tolerance and FHB resistance of Arabidopsis. By using the gene of the invention, it is expected to improve the scab resistance of plants and provide new and safe gene resources for disease-resistant breeding of transgenic wheat. Background technique [0002] Wheat is one of the most important food crops in the world. Fusarium head blight (FHB) is a fungal disease mainly caused by Fusarium graminearum. It mainly occurs in wa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/00
Inventor 廖玉才左东云李和平
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com