Specific primer for detecting salmonella pullorum, kit with primer and application of primer
A technology for Salmonella and pullorum, which is applied in the field of biotechnology detection to achieve the effects of accurate results, good specificity, and prevention of false elimination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Primer Design
[0023] A comprehensive bioinformatics analysis was performed on the whole genome of pullorum, typhoid and Salmonella enteritidis serotypes in GenBank, and finally the SEEP17495 gene (shown in SEQ ID NO.1) was determined as the detection target gene of pullorum pullorum.
[0024] According to the SEEP17495 gene, specific primers were designed using Oligo 6 software, and the primers were synthesized by Suzhou Jinweizhi Company. The primer sequences are as follows:
[0025] SEEP17495-idF: 5'CGATAATGGCAACCGCACTG 3' (shown in SEQ ID NO.2);
[0026] SEEP17495-idR: 5'TGATGTCTGCCCCTTTCGAC 3' (shown in SEQ ID NO.3).
Embodiment 2
[0027] Example 2: Establishment of PCR detection method for Salmonella pullorum serotype
[0028] 1. Experimental strains and reagents
[0029] The experimental strains are shown in Table 1, among which 11 isolates were isolated and identified by the Animal Bacteriosis Laboratory of Harbin Veterinary Research Institute.
[0030] Premix Ex Taq DNA polymerase and Marker DL2000 were purchased from TaKaRa Company.
[0031] Table 1 Experimental strains
[0032]
[0033]
[0034] Note: a: China Veterinary Microbiology Collection Management Center; b: China Medical Bacteria Collection Management Center; c: China Industrial Microbiology Culture Collection Management Center; d: American Type Culture Collection;
[0035] 2. Method
[0036] Step 1, DNA template preparation
[0037] Inoculate the strains listed in Table 1 into 5mL LB broth, culture overnight at 37°C with shaking at 200rpm, add 1mL of overnight cultured bacteria solution into a 1.5mL Eppendorf centrifuge tube, ce...
Embodiment 3
[0044] Embodiment 3: the test of the detection sensitivity of chicken manure simulated sample
[0045] Mix 1 g of chicken manure sample after autoclaving with 1 ml of 10× diluted bacterial solution, add LB broth to make up to 5 ml, shake at 37°C and 200 rpm for 5 hours; centrifuge the culture solution at 3000 rpm for 3 minutes and take the supernatant, The genome was extracted by the above method, and used as a template for PCR amplification using the PCR method established in Example 2, and the product was detected by 1.5% agarose gel electrophoresis.
[0046] image 3 It shows the results of the sensitivity test for the detection of simulated samples of chicken manure. The results show that the minimum concentration of Salmonella pullorum in the chicken manure samples can be detected when the bacteria are enriched for 5 hours. 3 cfu / mL, but at a concentration of 10 2 The PCR amplification result is negative at cfu / mL or lower concentration, indicating that the PCR method o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



