PCR detection primer group of avianleukosis (AL) viruses and kit comprising detection primer group
A technology for detection of avian leukosis virus and primers, applied in the field of molecular biology, can solve the problems of inapplicable, expensive, and time-consuming detection of whole groups in farms, and achieve the effects of simple and rapid typing detection, reduced time and cost, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: the design of PCR primer
[0028] Both ends of the RNA genome of the avian leukosis virus are non-coding regions, the middle part is a coding region, and the coding region has four structural genes. The invention designs primers for the special env gene sequence of the avian leukosis virus. After multiple rounds of screening, it was found that the following primers could quickly and accurately identify and detect subtype A, subtype B and subtype J of avian leukosis virus. Through PCR amplification, the length of the env gene sequence fragment can be obtained to distinguish which subtype of avian leukosis virus it is.
[0029] The PCR primer group nucleotide sequence of detection avian leukemia A, B and J subtype virus provided by the present invention is as follows:
[0030] P1: GGATGAGGTGACTAAGAAAG;
[0031] P2:GCATTACCACAGCGGTACTG;
[0032] P3:GTAAACGCCCGCCGGACT;
[0033] P4: CGAACCAAAGGTAACACACG.
[0034] The nucleotide sequence of the above primer...
Embodiment 2
[0035] Embodiment 2: the preparation of positive control plasmid and negative control
[0036] The positive control plasmid of ALV-A subtype virus is obtained by the following preparation method: take ALV-A subtype virus cDNA as template, carry out PCR amplification with P1 and P2 as primers, obtain the amplified product of 838bp, amplified product is reclaimed and After purification, it is cloned into the pMD18-T vector to obtain it.
[0037] The ALV-B subtype virus positive control plasmid is obtained by the following preparation method: take ALV-B subtype virus cDNA as template, carry out PCR amplification with P1 and P3 as primers, obtain the amplified product of 638bp, the amplified product is reclaimed and After purification, it is cloned into the pMD18-T vector to obtain it.
[0038] The positive control plasmid of ALV-J subtype virus is obtained by the following preparation method: take ALV-J subtype virus cDNA as template, carry out PCR amplification with P1 and P4 a...
Embodiment 3
[0040] Embodiment 3: the extraction of avian leukosis virus RNA
[0041] 1. Extraction of tissue total RNA
[0042]Take 10 mg of each tissue block into 1.5 mL Eppendorf microcentrifuge tubes, add 1 mL Trizol LS Reagent to each tube, and place at room temperature for 5 min after homogenization; add 200 μL chloroform to each tube, shake vigorously for 30 s, and place at room temperature for 15 min; 4°C, 12000r / min Centrifuge for 15 minutes; then transfer the upper aqueous phase to a new sterilized Eppendorf microcentrifuge tube, add an equal volume of isopropanol, invert and mix well, place at 4°C for more than 10 minutes, and centrifuge at 12,000 r / min for 10 minutes at 4°C; discard the supernatant Add 1000 μL of pre-cooled 75% ethanol to the precipitate to wash once, centrifuge at 12000 r / min for 10 min; carefully discard the supernatant, air-dry the precipitate, add an appropriate volume of DEPC-treated water to dissolve the RNA, and directly use it for reverse transcription ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



