Check patentability & draft patents in minutes with Patsnap Eureka AI!

PCR detection primer group of avianleukosis (AL) viruses and kit comprising detection primer group

A technology for detection of avian leukosis virus and primers, applied in the field of molecular biology, can solve the problems of inapplicable, expensive, and time-consuming detection of whole groups in farms, and achieve the effects of simple and rapid typing detection, reduced time and cost, and high sensitivity

Inactive Publication Date: 2017-06-20
SOUTH CHINA AGRI UNIV +1
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biggest disadvantage of this technology is that it is time-consuming, expensive, and it is not easy to test a large number of samples, and it is difficult to promote the use of clinical testing in large quantities.
Adopt ELISA kit to detect, its accuracy is higher, but there are two major disadvantages: 1) the price is very expensive, not suitable for whole group detection in farms; 2) ELISA reagent can only detect exogenous avian leukosis virus, and Inability to distinguish virus subtypes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detection primer group of avianleukosis (AL) viruses and kit comprising detection primer group
  • PCR detection primer group of avianleukosis (AL) viruses and kit comprising detection primer group
  • PCR detection primer group of avianleukosis (AL) viruses and kit comprising detection primer group

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: the design of PCR primer

[0028] Both ends of the RNA genome of the avian leukosis virus are non-coding regions, the middle part is a coding region, and the coding region has four structural genes. The invention designs primers for the special env gene sequence of the avian leukosis virus. After multiple rounds of screening, it was found that the following primers could quickly and accurately identify and detect subtype A, subtype B and subtype J of avian leukosis virus. Through PCR amplification, the length of the env gene sequence fragment can be obtained to distinguish which subtype of avian leukosis virus it is.

[0029] The PCR primer group nucleotide sequence of detection avian leukemia A, B and J subtype virus provided by the present invention is as follows:

[0030] P1: GGATGAGGTGACTAAGAAAG;

[0031] P2:GCATTACCACAGCGGTACTG;

[0032] P3:GTAAACGCCCGCCGGACT;

[0033] P4: CGAACCAAAGGTAACACACG.

[0034] The nucleotide sequence of the above primer...

Embodiment 2

[0035] Embodiment 2: the preparation of positive control plasmid and negative control

[0036] The positive control plasmid of ALV-A subtype virus is obtained by the following preparation method: take ALV-A subtype virus cDNA as template, carry out PCR amplification with P1 and P2 as primers, obtain the amplified product of 838bp, amplified product is reclaimed and After purification, it is cloned into the pMD18-T vector to obtain it.

[0037] The ALV-B subtype virus positive control plasmid is obtained by the following preparation method: take ALV-B subtype virus cDNA as template, carry out PCR amplification with P1 and P3 as primers, obtain the amplified product of 638bp, the amplified product is reclaimed and After purification, it is cloned into the pMD18-T vector to obtain it.

[0038] The positive control plasmid of ALV-J subtype virus is obtained by the following preparation method: take ALV-J subtype virus cDNA as template, carry out PCR amplification with P1 and P4 a...

Embodiment 3

[0040] Embodiment 3: the extraction of avian leukosis virus RNA

[0041] 1. Extraction of tissue total RNA

[0042]Take 10 mg of each tissue block into 1.5 mL Eppendorf microcentrifuge tubes, add 1 mL Trizol LS Reagent to each tube, and place at room temperature for 5 min after homogenization; add 200 μL chloroform to each tube, shake vigorously for 30 s, and place at room temperature for 15 min; 4°C, 12000r / min Centrifuge for 15 minutes; then transfer the upper aqueous phase to a new sterilized Eppendorf microcentrifuge tube, add an equal volume of isopropanol, invert and mix well, place at 4°C for more than 10 minutes, and centrifuge at 12,000 r / min for 10 minutes at 4°C; discard the supernatant Add 1000 μL of pre-cooled 75% ethanol to the precipitate to wash once, centrifuge at 12000 r / min for 10 min; carefully discard the supernatant, air-dry the precipitate, add an appropriate volume of DEPC-treated water to dissolve the RNA, and directly use it for reverse transcription ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR detection primer group of avianleukosis (AL) virus and a kit comprising the detection primer group. The PCR detection primer group of the avianleukosis virus comprises primers P1, P2, P3 and P4, wherein P1 is an upstream universal detection primer; P2 is a downstream primer for detecting ALV-A subtype virus; P3 is a downstream primer for detecting ALV-B subtype virus; and P4 is a downstream primer for detecting ALV-J subtype virus; and the diagnosis kit comprises the PCR detection primer group of the avianleukosis virus, ALV-A subtype virus positive control plasmid, ALV-B subtype virus positive control plasmid, ALV-J subtype virus positive control plasmid and negative control. With the application of the PCR detection primer group of the avianleukosis virus, it can rapidly and accurately detect whether poultry is affected with the leukemia subtype virus or not.

Description

technical field [0001] The invention relates to a PCR detection primer set for avian leukosis virus and a kit including the detection primer set, belonging to the technical field of molecular biology. Background technique [0002] With the continuous deepening of large-scale breeding in the poultry industry, the threat of poultry diseases has become increasingly prominent. Avian Leukosis (Avian Leukosis, AL) can infect all chicken breeds due to its high infection rate and its ability to spread both horizontally (cross-infection between chickens) and vertically (the disease can be passed on to the next generation). , Infected flocks show gradual onset, continuous low mortality, and are one of the main diseases that endanger the poultry industry. The global economic losses caused by poultry diseases are as high as tens of billions of dollars every year. Avian leukemia is a general term for a variety of tumor diseases in poultry caused by viruses in the avian leukosis sarcoma ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/701C12Q1/686C12Q2545/113
Inventor 罗琼陈瑞爱李延鹏李慧敏温良海
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More