Endo-xylanase mutant with improved pH, temperature and salt adaptability and application of endo-xylanase mutant

An endo-xylanase and mutant technology, which can be used in the fields of genetic engineering and protein modification, and can solve the problems of no catalytic activity and poor thermal stability.

Active Publication Date: 2017-06-30
YUNNAN NORMAL UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Endoxylanases have a wide range of sources and exist in a variety of bacteria, actinomycetes, fungi and other organisms, but xylanases directly screened from natural organisms often have advantages in certain enzymatic properties. However, it has disadvantages in another enzymatic property. For example, endoxylanases derived from molds often do not have catalytic activity under alkaline conditions, and endoxylanases derived from alkali-resistant microorganisms often do not have catalytic activity under acidic conditions. With catalytic activity, endoxylanases derived from thermophilic microorganisms often have no catalytic activity at low temperatures, while endoxylanases derived from microorganisms in low temperature environments often have poor thermal stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endo-xylanase mutant with improved pH, temperature and salt adaptability and application of endo-xylanase mutant
  • Endo-xylanase mutant with improved pH, temperature and salt adaptability and application of endo-xylanase mutant
  • Endo-xylanase mutant with improved pH, temperature and salt adaptability and application of endo-xylanase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Construction of mutant library

[0031] ①The genomes of Arthrobacter sp. and Lechevalieria sp. were extracted according to the instructions of the GENE STAR Bacterial Genome Extraction Kit.

[0032] ②According to the Arthrobacter sp. endoxylanase nucleotide sequence JQ863105 (SEQ ID No.3) recorded in GenBank, primers 5'GTGCAGCCGGAGGAAAAACG 3' and 5'GATGAAGGCAGGATCCGGGGT 3' were designed to target Arthrobacter sp. ) genome as a template for PCR amplification to obtain the endoxylanase gene xynAGN16L; in addition, according to the nucleotide sequence JF745868 (SEQ ID No. 4) Design primers 5'GTCTCGGCCCCGCCGGACGT 3' and 5'GGCTCGCTTCGCCAGCGTGG 3', and perform PCR amplification using the Lechevalieria sp. genome as a template to obtain the endoxylanase gene xynAHJ3.

[0033] ③PCR reaction parameters are: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min and 30 sec, and after 30 cycles, i...

Embodiment 2

[0039] Example 2: Screening of Mutants

[0040] 1) Take 2 μL of bacterial liquid from the 96-well cell culture plate in which the mutant library is stored, and inoculate it into 200 μL / well liquid LB culture medium (containing 100 μg mL -1 Amp) in a 96-deep-well plate at 37°C with shaking at 200rpm until OD 600 >1.0 (about 20h), add 2mM IPTG and 100μg mL -1 Amp was induced overnight at 20° C. with 160 rpm in 200 μL liquid LB culture solution.

[0041] 2) Add 40 μL / well of PopCulture after induction TM Cell lysate, shake and lyse cells at 25°C for 30 minutes.

[0042] 3) Take 50 μL of McIlvaine buffer (pH=7.0) containing 1.0% (w / v) beech xylan and 50 μL of cell lysate, and react in a 96 deep-well plate in a 70° C. incubator for 2 hours. After the reaction, add 150 μL of DNS reagent to terminate the reaction, incubate in a 140°C incubator for more than 20 minutes and cool to room temperature, and use a microplate reader to read the OD 540nm The value of E.coli BL21-Gold (DE...

Embodiment 3

[0046] Embodiment 3: Enzyme preparation of mutant S45F07 and wild enzyme rXynAGN16L and rXynAHJ3

[0047] The recombinant strains containing mutant S45F07, wild enzymes rXynAGN16L and rXynAHJ3 were inoculated in LB (containing 100 μg mL -1 Amp) medium, shake rapidly at 37°C for 16h.

[0048] Then inoculate the activated bacterial solution into fresh LB (containing 100 μg mL -1 Amp) culture medium, rapid shaking culture for about 2–3h (OD 600 After reaching 0.6-1.0), add IPTG at a final concentration of 0.1 mM for induction, and continue shaking culture at 20° C. for about 20 h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the bacteria with an appropriate amount of pH=7.0 Tris-HCl buffer solution, the bacteria were disrupted ultrasonically in a low-temperature water bath. The crude enzyme solution concentrated in the cells above was centrifuged at 13,000rpm for 10min, the supernatant was aspirated and the target protein was affinity and purified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of gene engineering and protein reconstruction, specifically to an endo-xylanase mutant with improved pH, temperature and salt adaptability and an application of the endo-xylanase mutant. The amino acid sequence of a mutant S45F07 is shown as SEQ ID NO. 1. Compared with a wild enzyme, the mutated endo-xylanase S45F07 has improved activity in the condition of pH being 4.0 and pH in a range of 9.0 to 11.0, the temperature of 80 DEG C and 90 DEG C, the concentration of NaCl in a range of 3.0-25.0% (w / v) and the concentration of KCl in a range of 20.0-30.0% (w / v). The mutated endo-xylanase S45F07 can be applied to the biological technical fields, particularly with high salt content, such as food, feed and papermaking industry.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and protein transformation, in particular to an endo-xylanase mutant with improved pH, temperature and salt adaptability and application thereof. Background technique [0002] Xylan is a rich source of hemicellulose, which can be degraded into xylooligosaccharides and / or xylose by endoxylanase, and the degradation products can be further fermented into other products or directly utilized. Glycanases are of great value in the fields of food, brewing, feed, textile and paper making (Collins et al. FEMS Microbiology Reviews, 2005, 29:3-23.). Endoxylanases have a wide range of sources and exist in a variety of bacteria, actinomycetes, fungi and other organisms, but xylanases directly screened from natural organisms often have advantages in certain enzymatic properties. However, it has disadvantages in another enzymatic property. For example, endoxylanases derived from molds often do not h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/24C12N15/56
CPCC12N9/248
Inventor周峻沛黄遵锡张蕊刘钰唐湘华李俊俊吴倩沈骥冬
OwnerYUNNAN NORMAL UNIV