Cas9 nuclease R919P and application thereof

A technology of nuclease and nuclease activity, applied in the field of Cas9 nuclease R919P, to achieve the effect of precise editing

Active Publication Date: 2017-07-11
SHANGHAI JIAO TONG UNIV
View PDF5 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the editing of DNA fragments can be realized through the CRISPR / Cas9 system, but for the in-depth study of the precise function of specific DNA segments, the Cas9 nuclease that can effectively realize the precise genetic editing of DNA fragments has yet to be discovered

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9 nuclease R919P and application thereof
  • Cas9 nuclease R919P and application thereof
  • Cas9 nuclease R919P and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1 Studying the Ligation of DNA Fragment Editing Adapters and Discovering a New Mechanism of Cas9 Cutting

[0078] For the HS51 site, construct the sgRNAs plasmid targeting the HS51 site:

[0079] (1) Purchase primers

[0080] Purchase forward and reverse deoxy oligonucleotides with 5' hanging ends "ACCG" and "AAAC" that can be complementary paired for the HS51 site and the sgRNAs targeting sequence respectively from Shanghai Sunny Biotechnology Co., Ltd.;

[0081] Targeting sequences of sgRNAs targeting the above HS51 site:

[0082] HS51 RE1 sgRNA1: GCCACACATCCAAGGCTGAC (SEQ ID NO.1)

[0083] HS51 RE1 sgRNA2: GAGATTTGGGGCGTCAGGAAG (SEQ ID NO.2)

[0084] (2) Obtain complementary paired double-stranded DNA with hanging ends

[0085] 1) use ddH 2 O Dissolve deoxyoligonucleotides to 100 μM and dilute to 20 μM;

[0086] 2) Add positive and negative deoxy oligonucleotides to the following reaction system:

[0087]

[0088] Reaction conditions: 95°C water bat...

Embodiment 2

[0152] Example 2 Mutation of SpCas9 to obtain a specific Cas9 with a changed cutting method to achieve precise DNA fragment editing

[0153] 1. Construction of Cas9 mutants

[0154] 1) Use NEB Mutagenesis Kit (Q5Site-Directed Mutagenesis Kit, #E0554S) to construct Cas9 mutants, first perform PCR amplification, and the reaction is as follows:

[0155]

[0156] Reaction conditions:

[0157] 2) KLD (Kinase, Ligase&DpnI) treatment, the reaction is as follows:

[0158]

[0159] Reaction conditions: 10 minutes at room temperature

[0160] 3) All the reaction products in 2) were used for the transformation of competent bacteria Stbl3 (50 μl), and cultured on LB plates containing ampicillin antibiotic (Amp, 100 mg / L) overnight at 37° C. Single clones were picked, plasmids were extracted and sent for sequencing.

[0161] The amino acid sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO.7, specifically:

[0162]

[0163]

[0164] The coding nucleotide sequence of SpCas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and specifically relates to Cas9 nuclease and an application. The Cas9 nuclease (Cas9-R919P) has the activity as Cas9 nuclease, fits to a CRISPR / Cas9 system, and is made by mutating the 919 location arginine of wild Cas9 nuclease to proline. A protruding fracture terminal is generated by cutting a DNA double chain with the Cas9 nuclease (Cas9-R919P), and a basic group complementary to the protruding fracture terminal is added in a filling-in manner, so that accurate addition at a specific position of the genome DNA segment can be carried out.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a Cas9 nuclease R919P and its application. Background technique [0002] Since the completion of the Human Genome Project and the Encyclopedia of DNA Elements, scientists have analyzed and identified a large number of genes and DNA regulatory elements in the genome [1,2]. DNA regulatory elements that play an important role in the regulation of gene expression include promoters, enhancers, silencers, and insulators. However, the functions of most regulatory elements have not been experimentally verified and elucidated [2-8]. Exploring the function of genes and DNA regulatory elements can be studied through genetic DNA segment editing. [0003] Early gene editing and gene function modification were achieved through gene transposition and transgenesis [9-14]. With the development of sequencing technology, reverse genetics has been applied to make specific mutations in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/55C12N15/63
CPCC12N9/22C12N15/63C12N2810/10
Inventor吴强李金环寿佳
OwnerSHANGHAI JIAO TONG UNIV