System for efficient screening of candidate sgRNAs for CRISPR/CAS9 gene editing system from plants and application

A technology of CAS9 and testing system, applied in the direction of DNA/RNA fragments, genetic engineering, recombinant DNA technology, etc., can solve the problem of inability to directly reflect the real cleavage of sgRNA target sites, low cleavage efficiency of sgRNA target sites, and inability to achieve high Throughput screening and other issues, to achieve the effect of convenient construction method, low cost and high detection throughput

Inactive Publication Date: 2017-08-11
江苏贝瑞利生物科技有限公司
View PDF1 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first method is only the result of computer prediction and has not been verified. It is still possible that the cutting efficiency of the sgRNA target site is not high or even impossible.
The latter method can only detect one candidate sgRNA target site at a time, which cannot achieve high-throughput screening, and the detection of the reporter gene is an indirect detection, which cannot directly reflect the real cleavage of the sgRNA target site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • System for efficient screening of candidate sgRNAs for CRISPR/CAS9 gene editing system from plants and application
  • System for efficient screening of candidate sgRNAs for CRISPR/CAS9 gene editing system from plants and application

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0023] Experimental Example 1: Screening Arabidopsis Rubisco small subunit gene candidate sgRNA

[0024] Use the CRISPR / CAS9 target site design website of Huazhong Agricultural University http: / / cbi.hzau.edu.cn / to select 5 high-scoring target sites for the Rubisco small subunit gene prediction candidate sgRNA target sites, and use edge cutting to select 5 target sites The 5 target sites were ligated into the pDgRNA vector by side-joining, and the sequence of the recombinant plasmid was confirmed by sequencing. The target sequence is as follows:

[0025] sgRNA target sequence 1: GTCGTTGTTAGCCTTGCGGGTGG

[0026] sgRNA target sequence 2: CGTGAGCACGGTAACTCACCCGG

[0027] sgRNA target sequence 3: ATAGAATATGTCTCGCAAACCGG

[0028] sgRNA target sequence 4: GGAGTCGGTGCAACCGAACAAGG

[0029] sgRNA target sequence 5: CGGAATCGGTAAGGTCAGGAAGG

[0030]Arabidopsis protoplasts were isolated using the Plant Protoplast Extraction Kit from Berelli Biotechnology Co., Ltd. The above plasmids...

experiment example 2

[0031] Experimental example 2: Screening candidate sgRNA for rice PAPST1 gene

[0032] Use the CRISPR / CAS9 target site design website of Huazhong Agricultural University to select 5 high-scoring target sites of rice PAPST1 gene candidate sgRNA target sites, and connect them into the pMgRNA vector by cutting and connecting them , and the sequence of the recombinant plasmid was confirmed by sequencing. The target sequence is as follows:

[0033] sgRNA target sequence 1: CCGCATAGTTCCTTACAGTGCGG

[0034] sgRNA target sequence 2: CCGCACTGTAAGGAACTATGCGG

[0035] sgRNA target sequence 3: ACATCATCAGGTTACCTCGAGG

[0036] sgRNA target sequence 4: CATGAATCAAGTCTTCGGACTGG

[0037] sgRNA target sequence 5: GCATCCAAAACCGTGTTGTAGGG

[0038] Rice leaf sheath protoplasts were isolated using the Plant Protoplast Extraction Kit from Berelli Biotechnology Co., Ltd. The above plasmids and the CAS9 expression vector pUCCAS9 were simultaneously transformed into rice protoplasts. Genomic DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a system for high-throughput screening of candidate sgRNA target sites for a CRISPR / CAS9 system and application thereof. The testing system comprises 1, plasmids for expressing multiple candidate sgRNAs at the same time; and 2, plasmids for expressing CAS9. Fast high-throughput identification of the cutting efficiency of the candidate sgRNA target sites can be achieved by means of an arabidopsis and rice protoplast transient expression system. It is important to select a target sequence capable of achieving efficient cutting before the CRISPR / CAS9 system knocks out or edits genes, the cutting efficiency of multiple candidate sgRNA target sites can be verified within a short period of time, so that the optimal sgRNA can be selected to improve the success rate of knockout, in this way, the working cost can be reduced, and working efficiency can be improved.

Description

technical field [0001] The present invention relates to a plant efficient screening CRISPR / CAS9 gene editing system candidate sgRNA system and its application. The transient expression system of Arabidopsis thaliana (dicot) and rice (monocot) can be used for fast and efficient screening and can be effectively used for editing plants Genomic sgRNA target sites. [0002] technical background [0003] Genome editing technology is an important technology for humans to transform biological genomes, and it has great application value in fields such as agriculture, medicine, and scientific research. CRISPR / Cas9 has become the most commonly used genome editing system because of its simplicity and efficiency. It is engineered from an immune mechanism in bacteria and archaea that degrades invading viruses or other foreign DNA sequences. It includes three elements: CAS9 protein, cr (CRISPR-derived RNA) RNA and tracr (trans-activatingcrRNA) RNA. In the CRISPR / CAS9 system, crRNA binds ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/113C12N15/66
CPCC12N15/113C12N15/66C12N15/8213C12N2310/10
Inventor郑天慧
Owner江苏贝瑞利生物科技有限公司