Unlock instant, AI-driven research and patent intelligence for your innovation.

Congenital Axenfeld-Rieger syndrome disease-causing gene rapid detection kit

A detection kit and disease-causing gene technology, applied in the field of genetic engineering, can solve the problems of false negatives and not covering the highly pathogenic gene FOXC1 mutation site, etc., and achieve the effect of simple operation, low cost and direct results

Inactive Publication Date: 2017-08-25
胡莹
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after a large sample of clinical verification, the test results of the above kit showed false negative results, and did not cover the mutation site of another highly pathogenic gene FOXC1 of this genetic disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Congenital Axenfeld-Rieger syndrome disease-causing gene rapid detection kit
  • Congenital Axenfeld-Rieger syndrome disease-causing gene rapid detection kit
  • Congenital Axenfeld-Rieger syndrome disease-causing gene rapid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 150ng of the extracted genomic DNA and specific primers for the PITX2 gene and the FOXC1 gene were amplified. After the PCR, 5ul of the PCR product was taken for electrophoresis analysis on 1.5% agarose gel. Specific steps are as follows.

[0027] 1. Primer dilution and storage.

[0028] Dilute the synthesized primers to 10 pmol / L according to the following steps.

[0029] (1) Calculate the molecular weight, mass number and molar number of each primer according to the instructions of the primer synthesis product, so as to calculate the need to add sterilized water (ddH 2 O) amount.

[0030] (2) Centrifuge the powdered primer at 12000rpm / min for a few seconds (to avoid flying and losing when opening).

[0031] (3) Carefully open the centrifuge tube containing the primers and add the ddH to be added 2 O.

[0032] (4) Shake and mix thoroughly.

[0033] (5) Centrifuge at 3000rpm / min for 5 minutes.

[0034] (6) Store at -20°C for long-term storage.

[0035] 2. PCR re...

Embodiment 2

[0043] 1. Dilute the primers at the 1121st position of the FOXC1 gene F: CTCAGCTCCGGCCTTCTG, R: CAAGTGGCCCAGGTCTCC; Dilute to 10pmol / L and store at -20°C for a long time.

[0044] 2.PCR reaction conditions: pre-denaturation at 94°C for 4min; 30 cycles, each cycle is pre-denaturation at 94°C for 35s, annealing at 59°C for 30s; extension at 72°C for 46s; final extension at 72°C for 10min.

[0045] 3. PCR reaction system: 25 µl, as follows.

[0046]

[0047] 4.1.5% agarose gel electrophoresis to identify PCR products: Take 3 μl of PCR products, add 2 μl 6×loading buffer, mix well, add to the sample well, and use 2 μl DNA Maker as a reference. Use 1.5% agarose gel electrophoresis at 100 V for 25 minutes, observe the DNA electrophoresis bands with a gel imaging system UV analyzer, and identify whether the PCR product is the target fragment for amplification, such as Figure 4 Shown is the PCR electrophoresis result of the 1121st point mutation of the FOXC1 gene.

[0048] 5. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a congenital Axenfeld-Rieger syndrome disease-causing gene rapid detection kit which comprises the following components: five pairs of specific primers designed by using PITX2 gene and FOXC1 gene mutation sites as detection objects, i.e., (1) TCATCTTCCTGTCACCATCC (SEQ ID No.1), CGCTCCCTCTTTCTCCATTT (SEQ ID No.2); (2) AGTAGGCGCCTAACAGCTAG, (SEQ ID No.3), TCTGATTTCCTTCCTGCCCA (SEQ ID No.4); (3) AGTTCCTGCAAGGCGGTCT (SEQ ID No.5), ACCTTGACGAAGCACTCGTT (SEQ ID No.6); (4) AGTTCATCATGGACCGCTTC (SEQ ID No.7), AGCTGTAGAGGGAGCTCTGG (SEQ ID No.8); (5) CTCAGCTCCGGCCTTCTG (SEQ ID No.9), CAAGTGGCCCAGGTCTCC (SEQ ID No.10). The kit further comprises the following components: deoxyribonucleoside triphosphate dNTP, Taq DNA polymerase, a DNA template, and 10*Buffer. The kit can very rapidly carry out PITX2 gene and FOXC1 gene detection of congenital Axenfeld-Rieger syndromes, and is simple to operate, direct and accurate in result, low in cost and particularly suitable for clinical popularization and application, and a very valuable detection method is provided for clinical and scientific research work.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a rapid detection kit for the causative gene of congenital Axenfeld-Rieger syndrome. Background technique [0002] Axenfeld-Rieger syndrome (Axenfeld-Rieger syndrome, ARS) is an autosomal dominant genetic disease with a specific clinical phenotype. The disease has complete penetrance and genetic heterogeneity. The incidence rate of the disease is 1:200000 , most of which are caused by genetic factors, the male and female ratio of the disease is equal, generally all are binocular disease, which has a serious impact on the patient himself and the whole family. [0003] The general features of ARS are mainly the retrocorneal embryonic ring, abnormal iris, glaucoma, vision loss and systemic abnormalities. The characteristic clinical manifestations are abnormalities of the anterior segment, including retrocorneal embryonic ring, iris dysplasia, and ectopic pup...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156
Inventor 胡莹刘驰张绍丹李若溪
Owner 胡莹