Unlock instant, AI-driven research and patent intelligence for your innovation.

Chimeric antigen receptor based on CD10, and applications thereof

A chimeric antigen receptor and antigen technology, which is applied in the field of tumor cell immunotherapy, can solve the problems of reduced expression, poor curative effect, and CD19 easily mutated expression, and achieves the effect of enhanced immune effect and high expression.

Active Publication Date: 2017-10-13
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chimeric antigen receptor gene-modified T cells targeting CD19 molecules (CD19 CAR-T) have achieved great success in the treatment of multiple and refractory acute B-lymphoblastic leukemia, while in refractory and relapsed chronic B-lymphoblastic leukemia. Significantly poorer outcomes in lymphocytic leukemia and B-lineage lymphoma
[0005] CN 104788573 A discloses a chimeric antigen receptor hCD19scFv-CD8α-CD28-CD3ζ and its application. The chimeric antigen receptor consists of anti-human CD19 monoclonal antibody HI19a light chain and heavy chain variable region (hCD19scFv), The hinge region of human CD8α, the transmembrane region and intracellular region of human CD28, and the intracellular region of human CD3ζ are constructed in tandem. After the CD19 in this patent is reinfused with CAR-T cells, the expression level of CD19 will decrease and it is easy to escape. immune mechanism
[0006] Therefore, it is particularly important to prepare a chimeric antigen receptor that can solve the problems of easy mutation and reduced expression of CD19

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor based on CD10, and applications thereof
  • Chimeric antigen receptor based on CD10, and applications thereof
  • Chimeric antigen receptor based on CD10, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Construction of Chimeric Antigen Receptor

[0054] (1) Synthesize Secretory signal peptide, CD10 antigen binding domain, CD8α and / or CD28 transmembrane domain, CD28 signaling domain, CD27 signaling domain and CD137 signaling domain, CD3ζ signaling domain through whole gene synthesis , 2A sequence and caspase 9 domain, such as figure 1 Shown, namely Secretory-CD10-CD28-CD27-CD137-CD3ζ-2A-FBKP.Casp9;

[0055] The nucleotide sequence SEQ ID NO.3 of the chimeric antigen receptor is as follows:

[0056] ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCGACATCGTGATGACCCAGAGCCCCGACAGCCTGGCCGTGAGCCTGGGCGACAGAGCCACCATCGCCTGCAGCGTGAGCAGCAGCATCAGCAGCAGCAACCTGCACTGGTACCAGCAGAAGCCCGGCCAGAGCCCCAAGCCCTGGATCTACGGCACCAGCAACCTGGCCAGCGGCGTGCCCGTGAGATTCAGCGGCAGCGGCAGCGGCACCAGCTACTTCACCCTGACCATCAGCAGCCTGCAGGCCGAGGACGTGGCCACCTACTACTGCCAGCAGTGGAGCAGCTACCCCCTGACCTTCGGCCAGGGCACCAAGGTGGAGATCAAGGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAGGGCGAGGTGCAGCTGGTGGAGAGC...

Embodiment 2

[0057] Example 2: Lentiviral packaging

[0058] (1) Culture 293T cells in a six-well plate, 1×10 6 cells / well, cultivated for 17-18 hours;

[0059] (2) Add 600 μL / well of fresh DMEM containing 10% FBS;

[0060](3) Add the following reagents to a sterile centrifuge tube: Take 75 μL of DMEM supernatant per well, 2.7 μg of helperDNA mix (1.8 μg pNHP, 0.5 μg pHEF-VSV-G, 0.2 μg pHEF-GFP) and 0.8 μg of pTYF DNA vector, vortex;

[0061] (4) Pipette 7 μL of Superfect from the center of each well plate into the centrifuge tube for 5 times, and let stand at room temperature for 7-10 minutes;

[0062] (5) Add the DNA-Superfect mixture in the centrifuge tube to each culture well drop by drop, and vortex to mix well;

[0063] (6) 37°C 3% CO 2 Cultivate in the incubator for 4-5 hours;

[0064] (7) Aspirate the culture medium of the medium, wash the medium with 1.5mL AIM-V, and add 1.5mL of AIM-V to continue culturing;

[0065] (8) Return the culture medium to 3% CO 2 Cultivate overn...

Embodiment 3

[0066] Example 3: Purification and concentration of lentivirus

[0067] 1) Virus purification

[0068] Cell debris was removed by centrifugation (1000g, 5 minutes) to obtain virus supernatant, which was filtered through a 0.45 micron low protein binding filter, virus was aliquoted and stored at -80°C;

[0069] Typically, transfected cells can produce 10 6 to 10 7 Lentiviral vectors for titration of transducing units.

[0070] 2) Concentrate lentiviral vectors with Centricon filters

[0071] (1) In a biological safety cabinet, take a Centricon tube, disinfect it once with 70% alcohol, and then wash it three times with sterile PBS;

[0072] (2) Add 18ml of virus supernatant to each Centricon P-20 filter tube, then centrifuge at 2500g for 30 minutes or until the virus volume is reduced to 0.5ml;

[0073] (3) Shake the filter tube, then centrifuge at 400g for 2 minutes to collect the concentrated virus into the collection cup. Finally, pool the virus in all tubes into one ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chimeric antigen receptor based on CD10, and applications thereof, and more specifically relates to a cell technology construction method of chimeric antigen receptor T (CAR-T) taking tumor specific target spot CD10 as a base, and applications of the chimeric antigen receptor T in treatment of tumor. The chimeric antigen receptor T is composed of an antigen binding domain, a transmembrane domain, a costimulatory signal transduction region, and a CD3 zeta signal transduction domine via series connection; wherein the antigen binding domain is used for binding tumor surface antigens, and the tumor surface antigen is CD10. According to applications, specific gene modification of single-chain antibody of tumor surface antigen CD10 is carried out, the modified antibody is capable of increasing antigen-antibody binding force, mutation is not easily caused. Compared with other chimeric antigen receptors and other tumor antigens, the chimeric antigen receptor possesses following advantages: the effect is better, target spot expression quantity is higher, immune effect on CAR-T cells is improved, and treatment effect of CAR-T cells is improved.

Description

technical field [0001] The present invention relates to the field of tumor cell immunotherapy, in particular to a CD10-based chimeric antigen receptor and its application, specifically the chimeric antigen receptor T (CAR-T) cell technology based on tumor-specific target CD10 The construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Usually, CAR contains the single chain fragment variable (single chain fragment variable, scFv) region of the antibody or the binding domain specific to the tumor associated antigen (tumor associated antigen, TAA), which commu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N7/01C12N5/10A61K35/17A61P35/00A61P35/02
CPCA61K35/17C07K14/7051C07K14/70517C07K14/70521C07K14/70578C07K16/2896C07K2317/622C07K2319/00C07K2319/02C07K2319/03C07K2319/33C12N5/0636C12N7/00C12N9/6472C12N2510/00C12N2740/15021C12Y304/22062
Inventor 李俊芳何晋元
Owner SHENZHEN GENO IMMUNE MEDICAL INST