TRAIL secretion mesenchyma stem cell and purpose thereof for encephaloma treatment
A cell and secretory signal peptide technology, applied in the field of gene recombination and stem cell application, can solve the problems of lack of secretory signal peptide sequence, poor water solubility of TRAIL protein, loss of activity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1 Preparation of the construct encoding the soluble fragment of secreted TRAIL protein
[0045] (1) A double-stranded DNA molecule having the nucleotide sequence of the following SEQ ID NO:4 was synthesized.
[0046] SEQ ID NO: 4:
[0047] tctagagccatgggtcgtcgagggcgtctgctggagatcgccctgggatttaccgtgcttttagcgtcctacacgagccatggggcggacgcccgtatgaaacagatcgaagacaaaattgaggagatccttagcaagatttaccatatagaaaacgagatcgctcgtattaaaaagcttatcggtgaacgtgaattcgtgagagaaagaggtcctcagagagtagcagctcacataactgggaccagaggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctctgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagggttttactacatctattcccaaacatactttcgatttcaggaggaaataaaagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatacacaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgttggtctaaagatgcagaatatggactctattccatctatcaagggggaatatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgagcacttgatagacatggaccatgaagccagttttttcggggcctttttagttggctaaggatcc。
[0048] These inclu...
Embodiment 2
[0058] Example 2 Construction of secreted TRAIL protein soluble fragment lentiviral expression vector pCDH-seTRAIL
[0059] (1) Double digestion of pCDH vector: The pCDH vector plasmid (System Biosciences Catalog: CD513B-1) was fully digested with restriction endonucleases Xba I and BamH I (NEB Company), and the digested product was gelatinized with 0.8% agarose Gel electrophoresis analysis, about 8000bp fragment was purified with the gel recovery kit of Qiagene company ( figure 2 ).
[0060] (2) Ligation and transformation of the digested product: the 711bp fragment coding DNA recovered from the digested enzyme obtained in Example 1 was mixed with the 8,000bp pCDH plasmid DNA recovered from the same digested enzyme in a molar ratio of 5:1, and mixed with T4 DNA ligase (NEB Company) was ligated overnight at 16°C to construct the expression vector pCDH-seTRAIL.
[0061] The ligation product was transformed into Escherichia coli stbls competent cells (stbls competent cells we...
Embodiment 3
[0063] Example 3 Packaging and transfection of lentiviral particles expressing secreted TRAIL protein soluble fragments
[0064] (1) Determination of expression plasmid pCDH-seTRAIL and helper plasmid concentration and purity
[0065] The third-generation lentiviral packaging system was used. In addition to the expression plasmid pCDH-seTRAIL, the packaging plasmid pMDLg / pRRE (purchased from Addgene, Catalog: 12251) and the packaging plasmid pRSV-REV (purchased from Addgene, Catalog: 12253) were also used; Coat protein particle pMD2G (purchased from Addgene, Catalog: 12259) completes the packaging of virus particles together.
[0066] Firstly, the purity and concentration of each plasmid DNA were analyzed by NanoDrop spectrophotometer. The results are shown in Table 1:
[0067] Table 1 The concentration and purity analysis results of each plasmid DNA
[0068]
[0069] (2) Plasmid co-transfect HEK293 cell line
[0070] Co-transfection plasmid recipe (per 15cm dish):
[...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



