Unlock instant, AI-driven research and patent intelligence for your innovation.

TRAIL secretion mesenchyma stem cell and purpose thereof for encephaloma treatment

A cell and secretory signal peptide technology, applied in the field of gene recombination and stem cell application, can solve the problems of lack of secretory signal peptide sequence, poor water solubility of TRAIL protein, loss of activity, etc.

Inactive Publication Date: 2017-10-24
SHENZHEN BEIKE BIOTECH
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

1.Secretability of TRAIL: General eukaryotic cell expression vectors lack effective secretory signal peptide sequences, and cannot deliver the expressed target protein to the extracellular medium, but accumulate inside the cell, which affects The accumulation of the target protein, on the other hand, also increases the difficulty for the subsequent separation and purification process
2. Solubility of TRAIL protein: The amino terminal of TRAIL protein molecule is a hydrophobic region transmembrane structure, and a large number of hydrophobic amino acid residues are concentrated, resulting in poor water solubility of TRAIL protein, which is easy to aggregate into agglomerates in solution and lose its activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TRAIL secretion mesenchyma stem cell and purpose thereof for encephaloma treatment
  • TRAIL secretion mesenchyma stem cell and purpose thereof for encephaloma treatment
  • TRAIL secretion mesenchyma stem cell and purpose thereof for encephaloma treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1 Preparation of the construct encoding the soluble fragment of secreted TRAIL protein

[0045] (1) A double-stranded DNA molecule having the nucleotide sequence of the following SEQ ID NO:4 was synthesized.

[0046] SEQ ID NO: 4:

[0047] tctagagccatgggtcgtcgagggcgtctgctggagatcgccctgggatttaccgtgcttttagcgtcctacacgagccatggggcggacgcccgtatgaaacagatcgaagacaaaattgaggagatccttagcaagatttaccatatagaaaacgagatcgctcgtattaaaaagcttatcggtgaacgtgaattcgtgagagaaagaggtcctcagagagtagcagctcacataactgggaccagaggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctctgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagggttttactacatctattcccaaacatactttcgatttcaggaggaaataaaagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatacacaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgttggtctaaagatgcagaatatggactctattccatctatcaagggggaatatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgagcacttgatagacatggaccatgaagccagttttttcggggcctttttagttggctaaggatcc。

[0048] These inclu...

Embodiment 2

[0058] Example 2 Construction of secreted TRAIL protein soluble fragment lentiviral expression vector pCDH-seTRAIL

[0059] (1) Double digestion of pCDH vector: The pCDH vector plasmid (System Biosciences Catalog: CD513B-1) was fully digested with restriction endonucleases Xba I and BamH I (NEB Company), and the digested product was gelatinized with 0.8% agarose Gel electrophoresis analysis, about 8000bp fragment was purified with the gel recovery kit of Qiagene company ( figure 2 ).

[0060] (2) Ligation and transformation of the digested product: the 711bp fragment coding DNA recovered from the digested enzyme obtained in Example 1 was mixed with the 8,000bp pCDH plasmid DNA recovered from the same digested enzyme in a molar ratio of 5:1, and mixed with T4 DNA ligase (NEB Company) was ligated overnight at 16°C to construct the expression vector pCDH-seTRAIL.

[0061] The ligation product was transformed into Escherichia coli stbls competent cells (stbls competent cells we...

Embodiment 3

[0063] Example 3 Packaging and transfection of lentiviral particles expressing secreted TRAIL protein soluble fragments

[0064] (1) Determination of expression plasmid pCDH-seTRAIL and helper plasmid concentration and purity

[0065] The third-generation lentiviral packaging system was used. In addition to the expression plasmid pCDH-seTRAIL, the packaging plasmid pMDLg / pRRE (purchased from Addgene, Catalog: 12251) and the packaging plasmid pRSV-REV (purchased from Addgene, Catalog: 12253) were also used; Coat protein particle pMD2G (purchased from Addgene, Catalog: 12259) completes the packaging of virus particles together.

[0066] Firstly, the purity and concentration of each plasmid DNA were analyzed by NanoDrop spectrophotometer. The results are shown in Table 1:

[0067] Table 1 The concentration and purity analysis results of each plasmid DNA

[0068]

[0069] (2) Plasmid co-transfect HEK293 cell line

[0070] Co-transfection plasmid recipe (per 15cm dish):

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a TRAIL secretion mesenchyma stem cell and a purpose thereof for encephaloma treatment, and relates to the field of gene recombination and stem cell application. Particularly, the invention provides a building body for expressing a secretion type TRAIL protein soluble fragment and a slow virus expression vector containing the building body. The invention also provides the mesenchyma stem cell integrating the building body on the genome; the TRAIL protein fragment can be expressed and secreted. The invention also provides application of the building body or the vector or the mesenchyma stem cell to encephaloma treatment.

Description

technical field [0001] The invention relates to the fields of gene recombination and stem cell application. Specifically, the present invention provides a construct capable of expressing a soluble fragment of secreted TRAIL protein, a lentiviral expression vector comprising the construct, and a stem cell integrated with the construct in its genome, which can express and secrete the TRAIL protein fragment. The present invention also provides the application of the construct, carrier or stem cell in the treatment of brain tumor or the preparation of brain tumor medicine. Background technique [0002] Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand, TRAIL) is a member of the Tumor Necrosis Factor superfamily, which mainly binds to the death receptors (DR4 and DR5) on the cell surface to initiate Extrinsic apoptotic pathway, thereby inducing tumor cell apoptosis. Moreover, the apoptosis-inducing activity is main...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C12N15/867C12N5/10A61K48/00A61K38/17A61K35/28A61K35/51A61P35/00
CPCA61K35/28A61K35/51A61K38/177A61K48/0066C07K14/70575C07K2319/02C12N5/0668C12N15/86C12N2510/02C12N2740/15043C12N2800/107C12N5/0622C12N2502/137C12N2510/00C12N2740/16043C12N5/10C12N2740/15032
Inventor 胡祥潘伟生路钢徐明恺刘沐芸苏献伟
Owner SHENZHEN BEIKE BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More