Unlock instant, AI-driven research and patent intelligence for your innovation.

Blood circulating tumor DNA point mutation detection method

A mutation type and mutation site technology, applied in the biological field, can solve the problem that blood biopsy is rarely used, and achieve the effect of low cost, strong specificity and high sensitivity

Inactive Publication Date: 2017-10-24
罗保君
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Specimens for mutation testing are usually derived from tumor tissue, mainly primary tumors, and blood biopsy is rarely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blood circulating tumor DNA point mutation detection method
  • Blood circulating tumor DNA point mutation detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Example 1, the establishment of cfDNA fluorescent quantitative PCR detection method and special kit

[0076] 1. Detection principle of cfDNA fluorescent quantitative PCR

[0077] The cfDNA in the sample is composed of mutant cfDNA and wild-type cfDNA, and the wild-type cfDNA accounts for the majority, but whether the mutant cfDNA contains it or how much it contains helps to judge whether the sample is cancerous or recurrent.

[0078] The schematic diagram of the principle is as figure 1 shown. The present invention designs the following specific primers and blocking sequences according to the mutant cfDNA and the wild-type cfDNA. The blocking sequence modified at the 3' end (3' end closed) contains the wild-type site corresponding to the mutation site. The blocking sequence The 3' end of the template is modified, and the modified sequence can specifically bind to the complementary sequence of the wild type, but cannot be extended, blocking the amplification of the wil...

Embodiment 2

[0092] Example 2. Application of cfDNA Fluorescent Quantitative PCR Kit in Detection of K-ras Mutation in Blood Samples of Patients with Lung Cancer

[0093] 1. Specific primers and blocking sequences for fluorescent quantitative mutant cfDNA and its special kit

[0094] There are mutant K-ras and wild-type K-ras in the tumor cells of lung cancer patients. Whether the K-ras gene is mutated or not and the amount of mutant K-ras play a key role in the efficacy and drug resistance of targeted drugs.

[0095] 1. Fluorescent quantitative mutant K-ras specific primers and blocking sequences

[0096] On the mutant K-ras gene, the nucleotide sequence of the mutant K-ras target sequence 69bp (60-100bp) containing the mutation site is selected as sequence 1, No. 49 Position A is a mutant base;

[0097] GCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTG GAGCTGGTGACGTAGGC AAGAGTGCCTTGA

[0098] The corresponding wild-type K-ras target sequence containing the wild-type site is the mutated base A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a blood circulating tumor DNA point mutation detection method. The provided complete set of primers comprise a specific primer with an amplification mutation type target sequence and a blockage sequence, wherein the mutation type target sequence is an area, containing mutant sites, of mutation type cfDNA, the specific primer with the amplification mutation type target sequence comprises a mutation type upstream primer and a mutation type downstream primer which are both bonded with the mutation type target sequence; the last basic group at the 3' tail end of the mutation type downstream primer and a mutant basic group located at a mutation site in the mutation type target sequence are complementary; the blockage sequence and a segment containing wild basic groups in a wild target sequence are complementary. The method has the advantages of being high in sensitivity, high in specificity, short in time consumption and low in cost, and multiple indexes can be detected simultaneously.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting DNA point mutations in circulating tumors. Background technique [0002] The discovery that cfDNA exists in the human circulatory system has strengthened its research in different clinical fields. The biggest advancement in cfDNA testing is that it has recently been approved for fetal sex identification. In 1948, Mandel and Metais used perchloric acid precipitation method to detect cfDNA in human plasma and serum, but this discovery did not attract everyone's attention at that time. After 30–40 years, cfDNA attracted many research groups, among them Leon It was found that the concentration of cfDNA in cancer patients was significantly increased, and Stroun confirmed that cfDNA was derived from tumors and carried the molecular characteristics of tumors, thus the concept of "liquid biopsy" was born. Because cfDNA detection can provide a lot of diagnostic, therap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q1/6886C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 罗保君
Owner 罗保君
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More