Embedded antigen receptor based on CD22 and application thereof

A chimeric antigen receptor, CD27 technology, applied in the field of tumor cell immunotherapy, can solve the problems of reduced expression, poor curative effect, easy mutation expression of CD19, etc., and achieve the effect of enhanced immune effect and high expression

Active Publication Date: 2017-11-03
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF5 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chimeric antigen receptor gene-modified T cells targeting CD19 molecules (CD19CAR-T) have achieved great success in the treatment of multiple, refractory acute B-lymphoblastic leukemia, while in refractory, relapsed chronic B-lymphoblastic leukemia Significantly poorer outcomes in treatment of leukemia and B-lineage lymphoma
[0005] CN 104788573A discloses a chimeric antigen receptor hCD19scFv-CD8α-CD28-CD3ζ and its application. The chimeric antigen receptor consists of anti-human CD19 monoclonal antibody HI19a light chain and heavy chain variable region (hCD19scFv), The hinge region of human CD8α, the transmembrane region and intracellular region of human CD28, and the intracellular region of human CD3ζ are constructed in tandem. After the CD19 in this patent is reinfused with CAR-T cells, the expression level of CD19 will decrease and it is easy to escape. immune mechanism
[0006] Therefore, it is particularly important to prepare a chimeric antigen receptor that can solve the problems of easy mutation and reduced expression of CD19

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Embedded antigen receptor based on CD22 and application thereof
  • Embedded antigen receptor based on CD22 and application thereof
  • Embedded antigen receptor based on CD22 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Construction of Chimeric Antigen Receptor

[0054] (1) Synthesize Secretory signal peptide, CD22 antigen binding domain, CD8α and / or CD28 transmembrane domain, CD28 signaling domain, CD27 signaling domain and CD137 signaling domain, CD3ζ signaling domain through whole gene synthesis , 2A sequence and caspase 9 domain, such as figure 1 Shown, namely Secretory-CD22-CD28-CD27-CD137-CD3ζ-2A-FBKP.Casp9;

[0055] The nucleotide sequence SEQ ID NO.3 of the chimeric antigen receptor is as follows:

[0056] ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCGACATCCAGATGACCCAGACCACCAGCAGCCTGAGCGCCAGCCTGGGCGACAGAGTGACCATCAGCTGCAGAGCCAGCCAGGACATCAGCAACTACCTGAACTGGTACCAGCAGAAGCCCGACGGCACCGTGAAGCTGCTGATCTACTACACCAGCATCCTGCACAGCGGCGTGCCCAGCAGATTCAGCGGCAGCGGCAGCGGCACCGACTACAGCCTGACCATCAGCAACCTGGAGCAGGAGGACTTCGCCACCTACTTCTGCCAGCAGGGCAACACCCTGCCCTGGACCTTCGGCGGCGGCACCAAGCTGGAGATCAAGGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAGGGCGAGGTGCAGCTGGTGGAGAGCGGCGGC...

Embodiment 2

[0057] Example 2: Lentiviral packaging

[0058] (1) Culture 293T cells in a six-well plate, 1×10 6 cells / well, cultivated for 17-18 hours;

[0059] (2) Add 600 μL / well of fresh DMEM containing 10% FBS;

[0060] (3) Add the following reagents to a sterile centrifuge tube: Take 75 μL of DMEM supernatant per well, 2.7 μg of helperDNA mix (1.8 μg pNHP, 0.5 μg pHEF-VSV-G, 0.2 μg pHEFeGFP) and 0.8 μg of pTYF DNA vector, vortex;

[0061] (4) Take 7 μL of Superfect from the center of each well plate, add it to the centrifuge tube and blow it 5 times, and let it stand at room temperature for 7-10 minutes;

[0062] (5) Add the DNA-Superfect mixture in the centrifuge tube dropwise to each culture well, and vortex to mix well;

[0063] (6) 37°C 3% CO 2 Cultivate in the incubator for 4-5 hours;

[0064] (7) Aspirate the culture medium of the medium, wash the medium with 1.5mL AIM-V, and add 1.5mL of AIM-V to continue culturing;

[0065] (8) Return the culture medium to 3% CO 2 Incuba...

Embodiment 3

[0066] Example 3: Purification and concentration of lentivirus

[0067] 1) Virus purification

[0068] Remove cell debris by centrifugation (1000g, 5 minutes) to obtain virus supernatant, filter the virus supernatant with a 0.45 micron low protein binding filter, virus is aliquoted and stored at -80°C;

[0069] Typically, transfected cells can produce 10 6 to 10 7 Transducing Units Titrated lentiviral vectors.

[0070] 2) Concentrate lentiviral vectors with Centricon filters

[0071] (1) In a biological safety cabinet, take a Centricon tube, disinfect it once with 70% alcohol, and then wash it three times with sterile PBS;

[0072] (2) Add 18ml of virus supernatant to each Centricon P-20 filter tube, then centrifuge at 2500g for 30 minutes or until the virus volume is reduced to 0.5ml;

[0073] (3) Shake the filter tube, then centrifuge at 400g for 2 minutes to collect the concentrated virus in the collection cup. Finally, pool the virus in all tubes into one centrifuge ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an embedded antigen receptor based on CD22 and application thereof, and particularly relates to a building method of an embedded antigen receptor T (CAR-T) cell technology based on a tumor specific target site CD22 and application thereof in anti-tumor treatment. The embedded antigen receptor is prepared by connecting an antigen binding structural domain, a transmembrane structural domain, a costimulatory signal conducting region and a CD3 zeta signal conducting structural domain in series, wherein the antigen binding structural domain is combined with tumor-surface antigen, and the tumor-surface antigen is CD22. By adopting the embedded antigen receptor, specific gene transformation on a single chain antibody of the tumor-surface antigen CD22 is carried out, and because of the transformed antibody, the binding force of the antigen-antibody is stronger, and the mutation difficultly occurs; compared with other embedded antigen receptors and other tumor antigens, the embedded antigen receptor has a better effect, and the expression quantity of the target site is high, so that an immunization effect of CAR-T cells is enhanced, and a treatment effect on the CAR-T cells is enhanced.

Description

technical field [0001] The present invention relates to the field of tumor cell immunotherapy, in particular to a CD22-based chimeric antigen receptor and its application, specifically the chimeric antigen receptor T (CAR-T) cell technology based on tumor-specific target CD22 The construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Usually, CAR contains the single chain fragment variable (Single chain fragment variable, scFv) region of the antibody or the binding domain specific to the tumor associated antigen (tumor associated antigen, TAA), which commu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N7/01C12N5/10A61K35/17A61P35/00A61P35/02
CPCA61K35/17C07K14/7051C07K14/70517C07K14/70521C07K14/70578C07K16/2896C07K2317/622C07K2319/00C07K2319/02C07K2319/03C07K2319/33C12N5/0636C12N7/00C12N9/6472C12N2510/00C12N2740/15021C12Y304/22062
Inventor章睿何晋元
OwnerSHENZHEN GENO IMMUNE MEDICAL INST