Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer probe, kit and method for accurate and quantitative detection of internal standard of transgenic rice

An internal standard gene, primer probe technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. Accurate and specific quantitative results

Inactive Publication Date: 2017-11-03
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the large number and variety of genetically modified foods, especially after many genetically modified foods are processed and stored under various conditions, the genetically modified ingredients are degraded in large quantities, making detection more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe, kit and method for accurate and quantitative detection of internal standard of transgenic rice
  • Primer probe, kit and method for accurate and quantitative detection of internal standard of transgenic rice
  • Primer probe, kit and method for accurate and quantitative detection of internal standard of transgenic rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] For the first time, the inventors of the present invention amplified the internal standard gene SPS of transgenic rice by real-time fluorescent PCR (probe method). Transgenic rice internal standard gene SPS primer probe sequence used is upstream primer RB-F2 CTAGAGGATCCCGGACGAGTG (SEQ ID No.1), downstream primer RB-R2ATGAGTGGTAGCGTCCAGAAGGAAA (SEQ ID No.2); the probe is RB-P2CTGGGGCAGATAAGCAGTAGTGGTGGG (SEQ ID No. .3).

[0028] 1. Main testing instruments used:

[0029] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.

[0030] 2. Main reagents for detection:

[0031] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.

[0032] 3. Main steps of detection:

[0033] Real-time fluorescent PCR reaction system:

[0034] 2×Mastermix 12.5μL

[0035] Upstream primer (10mM) 1.0μL

[0036] Downstream primer (10mM) 1.0μL

[0037] Pro...

Embodiment 2

[0048] In this example, the gene copy number of transgenic rice is quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice SPS strain. The probe sequence of the transgenic rice SPS strain-specific primer used is the upstream primer SPS-F1 GAGAACAAGAAGCCCCTTCTGTCTCG (SEQ ID No.1), and the downstream primer is SPS-R1AAGGTACTAAAGCTTGAAAATCCTAAGGC (SEQ ID No.2); the probe is SPS - P1CACATTCGGCAGTGAAACTCTTGAGCGCC (SEQ ID No. 3).

[0049] 1. Main testing instruments used:

[0050] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12000 r / min), etc.

[0051] 2. Main reagents for detection:

[0052] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.

[0053] 3. Main steps of detection:

[0054] Digital PCR reaction system:

[0055] 2×Mastermix 10 μL

[0056] Upstream primer (10mM) 1.0μL

[0057] Downstream primer (10mM) 1.0μL

[0058] Probe (10mM) 0.5μL

[0...

Embodiment 3

[0067] The same as the method described in Example 2, except that the genomic DNA of the transgenic rice sample was first diluted 5 times and then diluted 10 times in 3 gradients as a template, and each dilution gradient was repeated 3 times, using transgenic rice SPS amplification primers The probe sequence was the same as that in Example 2, and quantitative detection by digital PCR was carried out to determine the sensitivity of the method.

[0068] When the blank control (sterile double distilled water) had no amplification signal, the contents of the stock solution and its diluted 2, 4, 8, 16, and 32 times were 1845.3, 987.0, 480.0, 245.3, 123.3, 62.2 copies / μL, respectively, The deviations are far less than 20%, which are -0.53%, 6.42%, 3.5%, 5.79%, 6.35%, and 7.3%, respectively. The quantitative actual value basically conforms to its theoretical copy value, and the droplet distribution diagram of each concentration gradient has negative points Can be better distinguished...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an oligonucleotide primer probe for accurate and quantitative detection of a transgenic rice internal standard sucrose phosphate synthase (SPS) gene component, and a kit containing the primer probe. The present invention further relates to a digital PCR detection method for quantitatively detecting the transgenic rice internal standard gene SPS component, wherein the method comprises using the specific oligonucleotide primer and the fluorescent label probe for the transgenic rice internal standard gene SPS. The invention further relates to applications of the specific oligonucleotide primer and the fluorescent probe for the specific gene of the transgenic rice line in quantitative detection of the transgenic rice internal standard gene SPS component. According to the present invention, by using the digital PCR detection method, the transgenic rice internal standard gene SPS component content in the sample can be accurately and sensitively determined, and the absolute detection sensitivity can achieve 1 copy / [mu]L.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the invention relates to oligonucleotide primers and fluorescent labeling probes used for the detection of the internal standard gene SPS components of transgenic rice, and a kit containing the primer probes for determining transgene A digital PCR detection method for the SPS component of the internal standard gene of rice and the application of specific oligonucleotide primers and probes for the SPS component of the internal standard gene of transgenic rice in the detection of the SPS component of the internal standard gene of transgenic rice. Background technique [0002] With the extensive research on genetically modified products and their wide application in daily life, the safety issues brought by genetically modified products to human health and living environment have aroused widespread concern and controversy in the world. Therefore, while actively researching genetically modif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q1/6895C12Q2600/166C12Q2531/113C12Q2561/101C12Q2545/101
Inventor 陈颖邓婷婷黄文胜葛毅强吴亚君
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More