Plant glutelin transportation and storage related protein OsNHX5 as well as encoding gene and application of protein

A technology of gluten and gene, applied in the field of genetic engineering

Active Publication Date: 2017-11-10
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] NHX proteins play an important role in organisms, and there is no

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant glutelin transportation and storage related protein OsNHX5 as well as encoding gene and application of protein
  • Plant glutelin transportation and storage related protein OsNHX5 as well as encoding gene and application of protein
  • Plant glutelin transportation and storage related protein OsNHX5 as well as encoding gene and application of protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1. Discovery of glutenin transport and storage-related proteins and their encoding genes in plant seeds

[0047] 1. Distribution analysis and genetic analysis of mature glutenin content of rice mature glutenin-reducing mutant K67

[0048] In the indica rice variety N22 mutant library, using protein electrophoresis analysis, a strain with reduced mature glutenin content in seeds was screened, and its glutenin precursor was significantly increased compared with the normal type, named K67.

[0049] Compared with N22, the main characteristics of K67 are: the content of mature gluten in the seeds decreased (see figure 1 ), with massive accumulation of proglutenin and a seed opaque phenotype, see figure 2 .

[0050] Transmission electron microscopy of developing endosperm reveals that the type II protein bodies storing mature glutenin in K67 are relatively N22( image 3 A) The size is significantly smaller, and the shape of the type II protein body has also chang...

Embodiment 2

[0086] Embodiment 2, the acquisition and identification of transgenic plants

[0087] 1. Construction of recombinant expression vector

[0088] The OsVps9a gene was obtained by PCR amplification using the genomic DNA of Nipponbare (from the germplasm resource bank of the Rice Institute of Nanjing Agricultural University) as a template. The PCR primer sequences are as follows:

[0089] primer3:

[0090]5'AATTCGAGCTCGGTACCCGGGACCCACCTGAAAAAAAAAAAAAAT 3'

[0091] (SEQ ID NO.6);

[0092] primer4:

[0093] 5'CGACTCTAGAGGATCCCCGGGCTCGAGGGTGTAGTGCCCCTGCTGG3'

[0094] (SEQ ID NO. 7).

[0095] The above primers are located at 2.2kb upstream and 1.2kb downstream of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305 using the INFUSION recombination kit (Takara, Japan).

[0096] INFUSION recombination reaction system (10 μL): 1.0 μL of PCR ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of genetic engineering and relates to plant glutelin transportation and storage related protein OsNHX5 as well as an encoding gene and an application of the protein. The protein is protein shown in (a) or (b), wherein (a) is protein comprising an amino acid sequence shown in SEQ ID NO.1; (b) is plant glutelin transportation and storage related protein derived from SEQ ID NO.1 through substitution and/or deletion and/or addition of one or several amino acid residues of an amino acid sequence in SEQ ID NO.1. The plant glutelin transportation and storage related protein affects transportation and storage of glutelin precursors in plant endosperm. The encoding gene of the protein is introduced to plants which are abnormal in glutelin transportation and storage, and transgenic plants which are normal in glutelin transportation and storage can be cultured. The protein and the encoding gene thereof can be applied to genetic improvement of plants.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a plant gluten protein transport and storage related protein OsNHX5 and its coding gene and application. Background technique [0002] Rice is one of the most important food crops in the world. The successful application of hybrid rice has largely solved the food problem caused by the rapid increase in the world's population. However, with the continuous improvement of people's living standards, the cultivation of high-quality, high-nutrition and various functional rice is becoming an urgent problem. As the second largest nutrient in rice, rice seed storage protein determines the nutritional value of rice to a large extent. Therefore, the in-depth study of its synthetic transport pathway will help us improve rice through genetic engineering. [0003] Rice glutenin is first synthesized in the endoplasmic reticulum in the form of a 57kDa precursor, correctly folded with the assist...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/11A01H5/00
CPCC07K14/415C12N15/8243
Inventor 万建民朱建平王益华江玲鲍依群刘喜刘世家田云录陈亮明
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products