Plant glutelin transportation and storage related protein OsNHX5 as well as encoding gene and application of protein
A technology of gluten and gene, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1. Discovery of glutenin transport and storage-related proteins and their encoding genes in plant seeds
[0047] 1. Distribution analysis and genetic analysis of mature glutenin content of rice mature glutenin-reducing mutant K67
[0048] In the indica rice variety N22 mutant library, using protein electrophoresis analysis, a strain with reduced mature glutenin content in seeds was screened, and its glutenin precursor was significantly increased compared with the normal type, named K67.
[0049] Compared with N22, the main characteristics of K67 are: the content of mature gluten in the seeds decreased (see figure 1 ), with massive accumulation of proglutenin and a seed opaque phenotype, see figure 2 .
[0050] Transmission electron microscopy of developing endosperm reveals that the type II protein bodies storing mature glutenin in K67 are relatively N22( image 3 A) The size is significantly smaller, and the shape of the type II protein body has also chang...
Embodiment 2
[0086] Embodiment 2, the acquisition and identification of transgenic plants
[0087] 1. Construction of recombinant expression vector
[0088] The OsVps9a gene was obtained by PCR amplification using the genomic DNA of Nipponbare (from the germplasm resource bank of the Rice Institute of Nanjing Agricultural University) as a template. The PCR primer sequences are as follows:
[0089] primer3:
[0090]5'AATTCGAGCTCGGTACCCGGGACCCACCTGAAAAAAAAAAAAAAT 3'
[0091] (SEQ ID NO.6);
[0092] primer4:
[0093] 5'CGACTCTAGAGGATCCCCGGGCTCGAGGGTGTAGTGCCCCTGCTGG3'
[0094] (SEQ ID NO. 7).
[0095] The above primers are located at 2.2kb upstream and 1.2kb downstream of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305 using the INFUSION recombination kit (Takara, Japan).
[0096] INFUSION recombination reaction system (10 μL): 1.0 μL of PCR ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com