Unlock instant, AI-driven research and patent intelligence for your innovation.

Invariant natural killer T (iNKT) cell expressing targeted GPC3 chimeric antigen receptor and preparation and application for invariable natural killer T (iNKT) cell

A technology of chimeric antigen receptors and expression vectors, applied in the direction of receptor/cell surface antigen/cell surface determinant, anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, genetically modified cells, etc. It can solve the problems that the preparation method and application of CAR-iNKT cannot be derived from it

Active Publication Date: 2017-11-24
BEIJING GENE KEY LIFE TECH CO LTD
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the complex interactions in the immune system and the unknown mechanism of tumor formation, such a general list does not allow those skilled in the art to get any enlightenment on the availability of CAR-iNKT targeting GPC3, let alone draw specific and effective targeting CAR-iNKT from it. CAR-iNKT and its preparation method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Invariant natural killer T (iNKT) cell expressing targeted GPC3 chimeric antigen receptor and preparation and application for invariable natural killer T (iNKT) cell
  • Invariant natural killer T (iNKT) cell expressing targeted GPC3 chimeric antigen receptor and preparation and application for invariable natural killer T (iNKT) cell
  • Invariant natural killer T (iNKT) cell expressing targeted GPC3 chimeric antigen receptor and preparation and application for invariable natural killer T (iNKT) cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 iNKT cell culture expansion

[0051] (1) Human venous blood was collected using lithium heparin anticoagulated vacuum blood collection tubes. Using Lymphoprep separation medium, human peripheral blood mononuclear cells (PBMCs) were separated by density gradient centrifugation.

[0052] (2) PBMCs were washed three times with AIM V cell culture medium, resuspended in AIM V cell culture medium containing a final concentration of 100ng / mlα-GalCer and 500IU / mlrhIL-2, and inoculated in a 75cm 2 Cell culture flask, transfer to 37 °C, 5% CO 2 , cultured in a cell incubator with saturated humidity.

[0053] (3) Add AIM V cell culture medium containing 100ng / ml α-galactosylceramide and 500IU / mlrhIL-2 to the culture flask on the fourth day and the seventh day respectively, at 37°C, 5% CO 2 , continue culturing in a cell incubator with saturated humidity. Transfer cells to 225cm on day 10 2 Cell culture flasks, cultivated to the 14th day, use flow cytometry to sort ...

Embodiment 2

[0055] Example 2 Construction of chimeric antigen receptor protein lentiviral expression vector encoded by nucleic acid

[0056] Amplification and purification of nucleic acid fragments

[0057] (1) Amplification of scFv (GPC3) sequence

[0058] Sequence of template for scFv(GPC3) sequence:

[0059] GACGTGGTCATGACACAGAGCCCTCTGAGCCTGCCTGTGACACCTGGCGAACCTGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGCAACGGCAATACCTACCTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTCAGCTGCTGATCTACAAGGTGTCCAACCGGTTCAGCGGCGTGCCCGATAGATTTTCTGGCAGCGGCTCTGGCACCGACTTCACCCTGAAGATCTCCAGAGTGGAAGCCGAGGACGTGGGCGTGTACTACTGCAGCCAGAATACCCACGTGCCACCTACCTTTGGCCAGGGCACCAAGCTGGAAATCAAGAGAGGTGGCGGAGGATCTGGCGGAGGTGGAAGCGGCGGAGGCGGATCTCAAGTTCAGCTGGTTCAGTCTGGCGCCGAAGTGAAGAAACCTGGCGCCTCTGTGAAGGTGTCCTGCAAGGCCAGCGGCTACACCTTTACCGACTACGAGATGCACTGGGTCCGACAGGCTCCAGGACAAGGCTTGGAATGGATGGGAGCACTGGACCCCAAGACCGGCGATACAGCCTACAGCCAGAAATTCAAGGGCAGAGTGACCCTGACCGCCGACGAGTCTACAAGCACCGCCTACATGGAACTGAGCAGCCTGAGAAGCGAGGACCCGCCGTGTATTACTGTACCCGGTTCTACTCCTACA...

Embodiment 3

[0091] Example 3. Recombinant lentivirus infection of iNKT cells

[0092] The iNKT cells obtained in Example 1 were approximately 1×10 6 Add AIM V culture medium at a density of 1:1, add magnetic beads coated with anti-CD3 and CD28 antibodies, and rhIL-2 at a final concentration of 500 IU / ml to stimulate culture for 24 hours. Then the iNKT cells were infected with the above recombinant lentivirus at MOI ≈ 5. Infected cells were harvested every other day with 5 × 10 5 / mL density for subculture, and at the same time, rhIL-2 with a final concentration of 500U / mL was added to the lymphocyte culture medium. Infected iNKT cells were detected by flow cytometry on day 8 of culture, and uninfected iNKT cells were used as a negative control. The positive results of iNKT cells infected with viruses expressing chimeric antigen receptors are shown in the attached image 3 shown. This result indicates that a certain positive rate of CAR-iNKT cells can be obtained by lentiviral infectio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an invariant natural killer T (iNKT) cell expressing a targeted GPC3 chimeric antigen receptor and preparation and application for the iNKT cell. The chimeric antigen receptor contains a hinge region, a transmembrane region and an intracellular signal region of a single chain antibody GPC3-ScFv, CD8 which recognize a C tail end epitope of GPC3, wherein the hinge region, the transmembrane region and the intracellular signal region are connected according to series structure domains. Preparation of the iNKT cell modified by the chimeric antigen receptor comprises the following steps that a chimeric antigen receptor pRRL-gc33-28BBz is built, and the iNKT cell is infected; and after special amplification in vitro, the GPC3-targetted iNKT cell is obtained. According to the iNKT cell expressing the targeted GPC3 chimeric antigen receptor and preparation and application for the iNKT cell, the nucleic acids encoding the chimeric antigen receptor protein, a plasmid containing the nucleic acids, a virus containing the plasmid and the transgenic iNKT lymphocyte transduced by the virus can be effectively applied to tumor immunotherapy.

Description

technical field [0001] The invention relates to the field of tumor biotherapy, in particular to iNKT cells for adoptive immunotherapy, targeting solid tumors such as liver cancer expressing GPC3 antigen, and their preparation and application. Background technique [0002] Glypican-3 (GPC3) is a heparan sulfate proteoglycan expressed on the cell surface. GPC3 can be involved in cell division and the growth of cancer cells. The GPC3 protein is anchored on the cell membrane by glycosylphosphatidylinositol (GPI), and is cleaved by proteases to produce soluble amino-terminal peptides that enter human blood and membrane-bound carboxy-terminal peptides containing heparan sulfate (HS) sugar chains. Its spliced ​​body can be detected as a tumor antigen. [0003] GPC3 protein is highly expressed in fetal liver, but not in normal adult liver and normal tissues. GPC3 is highly expressed in liver cancer tissues, but not in cholangiocarcinoma and normal liver tissues. All cases of non...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C07K19/00C12N5/10C12N15/867A61K35/17A61P35/00
CPCA61K35/17C07K14/7051C07K14/70517C07K16/30C07K2317/622C07K2319/02C07K2319/03C12N5/0638C12N15/86C12N2510/00C12N2740/15043
Inventor 闾军陈辉孙文峰
Owner BEIJING GENE KEY LIFE TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More