Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CD117-based chimeric antigen receptor (CAR) and application thereof

A chimeric antigen receptor and antigen technology, which is applied in the field of tumor cell immunotherapy, can solve the problems of reduced expression, poor curative effect, and CD19 easily mutated expression, and achieves the effect of enhanced immune effect and high expression.

Active Publication Date: 2017-11-28
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chimeric antigen receptor gene-modified T cells targeting CD19 molecules (CD19CAR-T) have achieved great success in the treatment of multiple, refractory acute B-lymphoblastic leukemia, while in refractory, relapsed chronic B-lymphoblastic leukemia Significantly poorer outcomes in treatment of leukemia and B-lineage lymphoma
[0005] CN 104788573A discloses a chimeric antigen receptor hCD19scFv-CD8α-CD28-CD3ζ and its application. The chimeric antigen receptor consists of anti-human CD19 monoclonal antibody HI19a light chain and heavy chain variable region (hCD19scFv), human The hinge region of CD8α, the transmembrane region and intracellular region of human CD28, and the intracellular region of human CD3ζ are constructed in tandem. After the CD19 in this patent is reinfused with CAR-T cells, the expression level of CD19 will decrease and it is easy to escape immune mechanism
[0006] Therefore, it is particularly important to prepare a chimeric antigen receptor that can solve the problems of easy mutation and reduced expression of CD19

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CD117-based chimeric antigen receptor (CAR) and application thereof
  • CD117-based chimeric antigen receptor (CAR) and application thereof
  • CD117-based chimeric antigen receptor (CAR) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Construction of Chimeric Antigen Receptor

[0051] (1) Synthesize Secretory signal peptide, CD117 antigen binding domain, CD8α and / or CD28 transmembrane domain, CD28 signaling domain, CD137 signaling domain and / or CD27 signaling domain, CD3ζ signaling domain through whole gene synthesis Domain, 2A sequence and caspase 9 domain, namely Secretory-CD117-CD28-CD137-CD27-CD3ζ-2A-iCasp9;

[0052] The nucleotide sequence SEQ ID NO.3 of the chimeric antigen receptor is as follows:

[0053] ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCCAGGTGCAGCTGGTGCAGAGCGGCGCCGCCGTGAAGAAGCCCGGCGAGAGCCTGAAGATCAGCTGCAAGGGCAGCGGCTACAGATTCACCAGCTACTGGATCGGCTGGGTGAGACAGATGCCCGGCAAGGGCCTGGAGTGGATGGGCATCATCTACCCCGGCGACAGCGACACCAGATACAGCCCCAGCTTCCAGGGCCAGGTGACCATCAGCGCCGGCAAGAGCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCAGCGACACCGCCATGTACTACTGCGCCAGACACGGCAGAGGCTACAACGGCTACGAGGGCGCCTTCGACATCTGGGGCCAGGGCACCATGGTGACCGTGAGCAGCGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAG...

Embodiment 2

[0054] Example 2: Lentiviral packaging

[0055] (1) Culture 293T cells in a six-well plate, 1×10 6 cells / well, cultivated for 17-18 hours;

[0056] (2) Add 600 μL / well of fresh DMEM containing 10% FBS;

[0057] (3) Add the following reagents to a sterile centrifuge tube: Take 75 μL of DMEM supernatant per well, 2.7 μg of auxiliary DNA mixture (1.8 μg pNHP, 0.5 μg pHEF-VSV-G, 0.2 μg pHEF-GFP) And 0.8 μg of pTYF DNA vector, vortex;

[0058] (4) Pipette 7 μL of Superfect from the center of each well plate into the centrifuge tube for 5 times, and let stand at room temperature for 7-10 minutes;

[0059] (5) Add the DNA-Superfect mixture in the centrifuge tube to each culture well drop by drop, and vortex to mix well;

[0060] (6) 37°C 3% CO 2 Cultivate in the incubator for 4-5 hours;

[0061](7) Aspirate the culture medium of the medium, wash the medium with 1.5mL AIM-V, and add 1.5mL of AIM-V to continue culturing;

[0062] (8) Return the culture medium to 3% CO 2 Cultiva...

Embodiment 3

[0063] Example 3: Purification and concentration of lentivirus

[0064] 1) Virus purification

[0065] Cell debris was removed by centrifugation (1000g, 5 minutes) to obtain virus supernatant, which was filtered through a 0.45 micron low protein binding filter, virus was aliquoted and stored at -80°C;

[0066] Typically, transfected cells can produce 10 6 to 10 7 Lentiviral vectors for titration of transducing units.

[0067] 2) Concentrate lentiviral vectors with Centricon filters

[0068] (1) In a biological safety cabinet, take a Centricon tube, disinfect it once with 70% alcohol, and then wash it three times with sterile PBS;

[0069] (2) Add 18ml of virus supernatant to each Centricon P-20 filter tube, then centrifuge at 2500g for 30 minutes or until the virus volume is reduced to 0.5ml;

[0070] (3) Shake the filter tube, then centrifuge at 400g for 2 minutes to collect the concentrated virus into the collection cup. Finally, pool the virus in all tubes into one ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a CD117-based chimeric antigen receptor (CAR) and application thereof, in particular to a method for constructing a CRA-T cell technology based on a tumor specific target CD117 and application of the method in anti-tumor therapy. The CAR is formed by connecting an antigen binding domain, a transmembrane domain, a costimulatory signal transduction zone and a CD3 zeta signal transduction domain in series, wherein the antigen binding domain binds to a tumor surface antigen, and the tumor surface antigen is CD117. The CAR provided by the invention is obtained by carrying out specific genetic modification on the tumor surface antigen CD117, and the modified antibody can enable the antigen-antibody binding force to be stronger and is not easy to mutate. Compared with other CARs and other tumor antigens, the CD117-based CRA has better effects and high target expression quantity, thus enhancing the immune effect of CAR-T cells and improving the therapeutic effect of the CAR-T cells.

Description

technical field [0001] The present invention relates to the field of tumor cell immunotherapy, in particular to a CD117-based chimeric antigen receptor and its application, specifically the chimeric antigen receptor T (CAR-T) cell technology based on tumor-specific target CD117 The construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Usually, CAR contains the single chain fragment variable (single chain fragment variable, scFv) region of the antibody or the binding domain specific to the tumor associated antigen (tumor associated antigen, TAA), which com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867A61K35/17A61P35/00A61P35/02
CPCA61K35/17C07K14/7051C07K16/30C07K2319/02C07K2319/03C12N15/86C12N2740/15043
Inventor 桂思倩刘昱辰
Owner SHENZHEN GENO IMMUNE MEDICAL INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com