Method for rapidly obtaining CRISPR/Cas9 (clustered regularly interspersed short palindromic repeats/Cas9) gene knockout stable cell line through monoclonal cell sorting

A gene knockout and monoclonal technology, applied in the field of genetic engineering and genetic modification, can solve the problems of low screening efficiency, poor operability, high false positive rate, etc., achieve a wide range of applications, reduce false positive rate, edit high efficiency effect

Inactive Publication Date: 2017-12-01
XINXIANG MEDICAL UNIV
View PDF6 Cites 34 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Traditional cell line gene knockout requires multiple rounds of resistance screening and dilution after transfection to obtain positive monoclonals, which is very time-consuming and laborious, and the false positive rate is high
The Chinese invention patent with the publication number CN105950656A discloses a method for rapidly obtaining gene knockout cell lines. Only luciferase is used to screen cell lines. The screening efficiency is not high and the operability is not strong.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly obtaining CRISPR/Cas9 (clustered regularly interspersed short palindromic repeats/Cas9) gene knockout stable cell line through monoclonal cell sorting
  • Method for rapidly obtaining CRISPR/Cas9 (clustered regularly interspersed short palindromic repeats/Cas9) gene knockout stable cell line through monoclonal cell sorting
  • Method for rapidly obtaining CRISPR/Cas9 (clustered regularly interspersed short palindromic repeats/Cas9) gene knockout stable cell line through monoclonal cell sorting

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] In this embodiment, the method for rapidly obtaining a CRISPR / Cas9 knockout stable cell line comprises the following steps:

[0040] (1) Determine the specific target sites sgRNA1 and sgRNA2 of the gene Vav2 (Gene ID: 102718) to be knocked out: find the mouse Vav2 gene DNA sequence in the mouse genome database ensembl (http: / / asia.ensembl.org) (Transcript ID: ENSMUST00000056176.7), and then use the online design software CRISPOR (http: / / crispor.tefor.net / crispor.cgi) to determine the selection within the target site exon6 (exon ID: ENSMUSE00001307648) of the mouse Vav2 gene Two specific sites are used as the target sequence of sgRNA, the two target sequences are: sgRNA1 (SEQ ID NO.1): 5'-GTTAGAGATTCAGGAGACCG AGG-3', sgRNA2 (SEQ ID NO.2): 5'- GGCCAAGTACTACCGCACCC TGG-3', Vav2 gene knockout target site design as follows figure 1 shown.

[0041] (2) Design primers: According to step (1) sgRNA target sequence, design 2 pairs of 4 primers (Shanghai Bailige Biotechnology Co...

Embodiment 2

[0057] In this embodiment, the method for rapidly obtaining a CRISPR / Cas9 gene knockout stable cell line includes the following steps:

[0058](1) Determine the specific target sites sgRNA1 and sgRNA2 of the mouse gene Vav1 (Gene ID: 98923) to be knocked out: find the mouse Vav1 gene in the mouse genome database ensembl (http: / / asia.ensembl.org) DNA sequence (Transcript ID: ENSMUST00000005889), then use the online design software CRISPOR

[0059] (http: / / crispor.tefor.net / crispor.cgi), identified in the mouse Vav1 gene target site exon5 (exon ID:

[0060] ENSMUSE00000138941) select two specific sites as the target sequence of sgRNA, the two target sequences are: sgRNA1 (SEQ ID NO.9): 5'-CTACGAGGACCTAATGCGCT TGG-3', sgRNA2 (SEQ ID NO.10): 5'-CGAGGACCTTTTATGACTGCG TGG-3'.

[0061] (2) Design primers: According to step (1) sgRNA target sequence, design 2 pairs of 4 primers (Shanghai Bailige Biotechnology Co., Ltd.), and add a BbsI restriction site at the 5' end of the primer se...

Embodiment 3

[0077] In this embodiment, the method for rapidly obtaining a CRISPR / Cas9 gene knockout stable cell line includes the following steps:

[0078] (1) Determine the specific target sites sgRNA1 and sgRNA2 of the mouse gene DSG4 (Gene ID: 2661061) to be knocked out: find the mouse DSG4 gene in the mouse genome database ensembl (http: / / asia.ensembl.org) DNA sequence (Transcript ID: ENSMUST00000019426.4), and then use the online design software CRISPOR (http: / / crispor.tefor.net / crispor.cgi) to determine the target site exon12 (exonID: ENST00000308128.8) in the mouse DSG4 gene ) to select two specific sites as the target sequence of sgRNA, the two target sequences are: sgRNA1 (SEQ ID NO.17): 5'-CTTAGCCGTAAGGATTGCCG AGG-3', sgRNA2 (SEQ ID NO.18): 5'-GTGGTTGTCATCGCAATCAC AGG-3'.

[0079] (2) Design primers: According to step (1) sgRNA target sequence, design 2 pairs of 4 primers (Shanghai Bailige Biotechnology Co., Ltd.), and add a BbsI restriction site at the 5' end of the primer seq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for rapidly obtaining a CRISPR / Cas9 (clustered regularly interspersed short palindromic repeats / Cas9) gene knockout stable cell line through monoclonal cell sorting and belongs to the technical field of genetic engineering and genetic modification. According to the method, a CRISPR / Cas9 system, single-cell sorting by a flow cytometer and fluorescent protein screening on an expression vector are combined, positive monoclonal cells can be obtained in short time, and gene knockout work efficiency of the cell line is greatly improved. Compared with a traditional cell line gene knockout method, the flow cytometer is utilized for single-cell sorting, on one hand, tedious work of antibiotic screening is omitted, so that a large quantity of single cells can be obtained in quite short time, and on the other hand, the condition that cells in each culture hole are single cells can be guaranteed and false positive rate is reduced. Sorting is performed 40-80 h after cell transfection, at the time point, the highest survival rate of the cells after sorting can be guaranteed, and the screening efficiency is improved accordingly.

Description

technical field [0001] The invention relates to a method for rapidly obtaining a CRISPR / Cas9 gene knockout stable cell line by sorting monoclonal cells, and belongs to the technical field of genetic engineering and genetic modification. Background technique [0002] CRISPR refers to clustered, regular short palindromic repeats (Clustered Regularly Interspersed Short Palindromic Repeats). The CRISPR-Cas9 system is mainly composed of three parts, namely Cas9 protein, precursor CRISPR RNA (pre-crRNA) and trans-activating crRNA (tracrRNA). With the help of the latter two, the former can recognize and target specific DNA sequence, cutting it causes double-strand DNA breaks, and eventually causes frameshift mutations, resulting in gene knockout. Compared with traditional gene editing methods, the CRISPR-Cas9 system has a simple structure, easy vector construction, high genome editing efficiency, and no species restrictions in actual use, so it is widely used in gene knockout in a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90
CPCC12N15/85C07K14/47C07K14/4702C12N15/907C12N2810/10
Inventor卢燎勋张黎琛梁银明黄蓉晁天柱郑前前罗静谷妍蓉袁鹏
OwnerXINXIANG MEDICAL UNIV