MiRNA (micro ribonucleic acid) sequence for regulating and controlling organ development of brassica oleracea and application of miRNA sequence

A cauliflower and sequence technology, applied in the direction of DNA / RNA fragments, applications, recombinant DNA technology, etc., can solve problems such as limited understanding, and achieve the effect of low requirements for the operating environment, simple operation process, and high broad-spectrum

Active Publication Date: 2017-12-08
NANKAI UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the understanding of the regulation of cauliflower organ development, especially the regulation mechanism mediated by miRNA is very limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiRNA (micro ribonucleic acid) sequence for regulating and controlling organ development of brassica oleracea and application of miRNA sequence
  • MiRNA (micro ribonucleic acid) sequence for regulating and controlling organ development of brassica oleracea and application of miRNA sequence
  • MiRNA (micro ribonucleic acid) sequence for regulating and controlling organ development of brassica oleracea and application of miRNA sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] A miRNA-1 precursor sequence that plays a key regulatory role in cauliflower organ development, which consists of the sequence 5'ATTTCAGGTGATGTAGTTGAGAAGTAGCTGTAAAGCTCAGGAGGGATAGCGCCATGTCTCACCGGTACTATAAAATGTTTGTATATCTATATTGGCGCTATCCATCCTGAGTTCTATGGCTTCTTCTTGCTTTTATCCTGAGAT 3' (SEQ ID NO: 1).

[0038] Utilize above-mentioned miRNA precursor sequence to cultivate the method for tall plant, little branch transgenic plant, it comprises the steps:

[0039] (1) Total DNA extraction from cauliflower:

[0040] The plant DNA extraction kit sold by Shanghai Bioengineering Company was used to extract the total DNA of cauliflower. The specific process is as follows: ① Weigh about 50 mg of cauliflower into a mortar that has been pre-cooled with liquid nitrogen, and fully grind it into powder in liquid nitrogen (continuously add liquid nitrogen during the grinding process), and grind the ground material Transfer to the lysate provided in the kit, vortex and mix well, bathe in 65°C w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a miRNA (micro ribonucleic acid) sequence for regulating and controlling organ development of brassica oleracea and a method for culturing a genetically-modified plant with large plant height and few branches by the aid of the sequence. The method comprises steps as follows: (1), extraction of total DNA (deoxyribonucleic acid) of the brassica oleracea; (2), amplification of a miRNA-1 precursor of the brassica oleracea; (3), construction and identification of miRNA-1 plant overexpression vector of the brassica oleracea; (4), genetic transformation; (5), resistance screening and molecular identification of miRNA-1 transgenic arabidopsis; (6), phenotypic analysis of the miRNA-1 overexpression transgenic arabidopsis. A result shows that the plant height of the genetically-modified plant is remarkably larger than that of a wild type plant; plant stem branches of the genetically-modified plant are remarkably fewer than those of the wild type plant. The miRNA sequence and the method for culturing the genetically-modified plant with large plant height and few branches by the aid of the sequence have great value in the aspects of disclosing a regulating and controlling mechanism of miRNA for organ development of the brassica oleracea and adopting genetic engineering methods to interfere with plant organ development process so as to culture crops or economic plants, meeting a breeding objective, with large plant height and few branches.

Description

technical field [0001] The invention belongs to the technical field of modern molecular biology transgenic plants, and relates to a miRNA sequence in biotechnology that plays a key regulatory role in cauliflower organ development and its application in cultivating tall plants and few branched transgenic plants. Background technique [0002] MicroRNA (miRNA) is a class of small molecule RNA that is endogenous, non-coding, and has regulatory functions in eukaryotes. As a regulatory factor at the post-transcriptional level, it widely exists in animals and plants. In plants, miRNA genes are transcribed into precursor miRNAs (pri-miRNAs), and pri-miRNAs are cut into mature stem-loop structure precursors (pre-miRNA) under the action of DCL1, and pre-miRNAs are further cut by DCL1 to produce miRNA / miRNA * Double-stranded molecules. Then the miRNA* chain is degraded, miRNA and AGO1 (Argonaute 1) protein together form the RNA-induced silencing complex (RNA-induced silencing complex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00
CPCC12N15/113C12N15/8222C12N15/8261C12N2310/141
Inventor王春国李慧陈成彬宋文芹
OwnerNANKAI UNIV