Recombinant nitrite reductase and construction method thereof
A nitrite and construction method technology, applied in the field of recombinant nitrite reductase and its construction, can solve the problems of difficult purification and low NiR content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Construction of recombinant bacteria pET32a-nir-BL21 and trial expression of NiR
[0039] (1) Using the nitrite reductase coding gene of Bacillus cereus in NCBI as a template, design the upstream primer as CCAGGATCCGAAAACCTGTATTTTTCAGGGAATGAGTTATGAAAAAG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the enzyme cutting sites as BanH I and Xho I respectively;
[0040] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );
[0041] (3) Cut the amplified fragment and the plasmid pET21a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET32a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shoc...
Embodiment 2
[0048] Example 2 Construction of recombinant bacteria pET28a-nir-Rosetta2 and trial expression of NiR
[0049] (1) Using the gene encoding Bacillus cereus nitrite reductase in NCBI as a template, design the upstream primer as CCAGCTAGCATGAGTTATGAAAAAGTATG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the restriction sites as Nde I and Xho I;
[0050] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );
[0051] (3) Cut the amplified fragment and the plasmid pET28a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET28a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and in...
Embodiment 3
[0058] Example 3 Construction of recombinant bacteria pET28a-nir-BL21 and trial expression of nitrite reductase
[0059] (1) Using the gene encoding Bacillus cereus nitrite reductase in NCBI as a template, design the upstream primer as CCAGCTAGCATGAGTTATGAAAAAGTATG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the restriction sites as Nde I and Xho I;
[0060] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );
[0061] (3) Cut the amplified fragment and the plasmid pET28a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET28a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 secon...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap