Recombinant nitrite reductase and construction method thereof

Abstract

The invention discloses recombinant nitrite reductase and a construction method of the recombinant nitrite reductase. An NiR (nitrite reductase) gene in bacillus cereus LJ01 is amplified by adopting the PCR technology, the amplified gene is cloned to a carrier, an expression host strain is transformed, recombinant bacteria induced by IPTG is added, shaking culture is carried out at 16-37 DEG C, fermentation liquor is centrifugalized, bacterial sludge is taken, resuspending is carried out, high-pressure grinding is carried out, and crude enzyme liquid is extracted, wherein the bacillus cereus LJ01 is assigned with the accession number of CGMCC NO.9360. According to the technical scheme, the NiR gene is cloned, the cloned gene is expressed in a large amount in a host cell, meanwhile, the recombinant protein is provided with a specific label through plasmids, so that the purification process is simplified, and the extraction amount of NiR is improved.

Description

technical field

[0001] The present invention relates to the gene cloning of Bacillus cereus LJ01 nitrite reductase and the attempt to express the target protein at a culture temperature of 16°C to 37°C respectively, and SDS-PAGE is used to compare and analyze the expression of the recombinant protein, so as to determine the expression of NiR The optimal induction temperature is 16°C for 20-24 hours of shaking culture, which is beneficial to subsequent scale-up experiments and related research. Background technique

[0002] Nitrate and nitrite mainly enter the human body through eating vegetables. Nitrite is a toxic substance. After human consumption, it will produce carcinogenic nitrosamines in the body, which can cause gastric cancer, intestinal cancer, and liver cancer. Nitrite can induce methemoglobin (Methemoglobin), resulting in common symptoms of acute nitrite poisoning. Therefore, it is very important to strictly control the content of nitrite in food. Most of the d...

Examples

Embodiment 1

[0038] Example 1 Construction of recombinant bacteria pET32a-nir-BL21 and trial expression of NiR

[0039] (1) Using the nitrite reductase coding gene of Bacillus cereus in NCBI as a template, design the upstream primer as CCAGGATCCGAAAACCTGTATTTTTCAGGGAATGAGTTATGAAAAAG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the enzyme cutting sites as BanH I and Xho I respectively;

[0040] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );

[0041] (3) Cut the amplified fragment and the plasmid pET21a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET32a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shoc...

Embodiment 2

[0048] Example 2 Construction of recombinant bacteria pET28a-nir-Rosetta2 and trial expression of NiR

[0049] (1) Using the gene encoding Bacillus cereus nitrite reductase in NCBI as a template, design the upstream primer as CCAGCTAGCATGAGTTATGAAAAAGTATG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the restriction sites as Nde I and Xho I;

[0050] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );

[0051] (3) Cut the amplified fragment and the plasmid pET28a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET28a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and in...

Embodiment 3

[0058] Example 3 Construction of recombinant bacteria pET28a-nir-BL21 and trial expression of nitrite reductase

[0059] (1) Using the gene encoding Bacillus cereus nitrite reductase in NCBI as a template, design the upstream primer as CCAGCTAGCATGAGTTATGAAAAAGTATG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the restriction sites as Nde I and Xho I;

[0060] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );

[0061] (3) Cut the amplified fragment and the plasmid pET28a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET28a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 secon...

technical field

[0001] The present invention relates to the gene cloning of Bacillus cereus LJ01 nitrite reductase and the attempt to express the target protein at a culture temperature of 16°C to 37°C respectively, and SDS-PAGE is used to compare and analyze the expression of the recombinant protein, so as to determine the expression of NiR The optimal induction temperature is 16°C for 20-24 hours of shaking culture, which is beneficial to subsequent scale-up experiments and related research. Background technique

[0002] Nitrate and nitrite mainly enter the human body through eating vegetables. Nitrite is a toxic substance. After human consumption, it will produce carcinogenic nitrosamines in the body, which can cause gastric cancer, intestinal cancer, and liver cancer. Nitrite can induce methemoglobin (Methemoglobin), resulting in common symptoms of acute nitrite poisoning. Therefore, it is very important to strictly control the content of nitrite in food. Most of the d...

Examples

Embodiment 1

[0038] Example 1 Construction of recombinant bacteria pET32a-nir-BL21 and trial expression of NiR

[0039] (1) Using the nitrite reductase coding gene of Bacillus cereus in NCBI as a template, design the upstream primer as CCAGGATCCGAAAACCTGTATTTTTCAGGGAATGAGTTATGAAAAAG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the enzyme cutting sites as BanH I and Xho I respectively;

[0040] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );

[0041] (3) Cut the amplified fragment and the plasmid pET21a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET32a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shoc...

Embodiment 2

[0048] Example 2 Construction of recombinant bacteria pET28a-nir-Rosetta2 and trial expression of NiR

[0049] (1) Using the gene encoding Bacillus cereus nitrite reductase in NCBI as a template, design the upstream primer as CCAGCTAGCATGAGTTATGAAAAAGTATG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the restriction sites as Nde I and Xho I;

[0050] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );

[0051] (3) Cut the amplified fragment and the plasmid pET28a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET28a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and in...

Embodiment 3

[0058] Example 3 Construction of recombinant bacteria pET28a-nir-BL21 and trial expression of nitrite reductase

[0059] (1) Using the gene encoding Bacillus cereus nitrite reductase in NCBI as a template, design the upstream primer as CCAGCTAGCATGAGTTATGAAAAAGTATG, the downstream primer as TGGCTCGAGCTAAGACGCTATTACTTC, and the restriction sites as Nde I and Xho I;

[0060] (2) Extract the DNA of Bacillus cereus (Bacillus cereus) LJ01 (preservation number is CGMCC NO.9360), and use this as a template to amplify the gene fragment of B. cereus LJ01 nitrite reductase (nir );

[0061] (3) Cut the amplified fragment and the plasmid pET28a into two fragments at 37°C by using the upstream and downstream tool enzymes; recover the above two fragments with a recovery kit, connect them with T4 DNA ligase, and make the recombinant plasmid pET28a-nir Add it to 50 μL Top10 competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 secon...

Images