Primer pair, probe, kit and method for detecting I-type bovine herpes virus

A bovine herpes virus and primer pair technology, applied in the field of bioengineering, can solve the problems of poor specificity, time-consuming, poor sensitivity, etc., and achieve the effects of optimized reaction conditions, broad application prospects, and high sensitivity

Inactive Publication Date: 2018-02-13
NANJING AGRICULTURAL UNIVERSITY +4
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing detection methods include serum neutralization test (SN), agar diffusion test, indirect hemagglutination test, ELISA and nucleic acid probe detection, etc., but these methods h

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair, probe, kit and method for detecting I-type bovine herpes virus
  • Primer pair, probe, kit and method for detecting I-type bovine herpes virus
  • Primer pair, probe, kit and method for detecting I-type bovine herpes virus

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0026] Example 1 Establishment of TaqMan probe fluorescence quantitative PCR detection method for type I bovine herpes virus gE gene

[0027] 1. Method

[0028] 1.1 Standard quality particle construction and primer and probe design

[0029] Using the full genome sequence of the BHV-1Cooper strain (accession number: KU198480.1), the gE gene sequence 1607-1704bp specific region sequence gtcgctctgggttcaaagtttggtttagggacccgcttgaagacgatgccgcgccagcgc ggaccccggccgcaccagattacaccgtggtagcagcg (SEQ ID NO: KU198480.1) was selected to construct the plasmid pegccggccgcaccagattacaccgtggtagcagcg (SEQ ID NO: 57) Standard product sequence. At the same time, the conserved and specific regions were selected to design primers and probes through BLAST comparison analysis. The primers and TaqMan probes were designed at the 1607-1704bp position of the gE gene sequence of the BHV-1Cooper strain as follows:

[0030] qBHV-gE-1607F: 5'-GTCGCTCTGGGTTCAAAGT-3' (SEQ ID NO. 1);

[0031] qBHV-gE-1704R: 5'-GCTGCTACCAC...

Example Embodiment

[0051] Example 3 Detecting clinical samples by using the TaqMan probe fluorescence quantitative PCR detection method of type I bovine herpes virus gE gene established in the present invention

[0052] 1. Clinical sample testing

[0053] Select 4 dairy farms in Table 2, collect 500 nasal cotton swabs and 100 vaginal secretions, and use the fluorescent quantitative PCR method of Example 1 to carry out BHV-1 detection.

[0054] Table 2 Sample collection

[0055]

[0056] 2. Test results

[0057] After real-time PCR detection by TaqMan probe method, it was found that the positive number of nasal cotton swab samples collected by 3 small dairy farms was relatively small (1% -1.5%), while the positive rate of large farms reached 20% (see table 3). In vagina swabs, the positive rate of large farms is as high as 30%, and the number of positives in small dairy farms is between 0-5%, which is significantly lower than that of large farms (P <0.01). This shows that both the respiratory tract type...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer pair, a probe, a kit and a method for detecting type I bovine herpes virus. The primer pair and the probe are aimed at positions 1607-1704 of the gE gene sequence of type I bovine herpes virus Cooper strain. A pair of primers and a probe designed for the nucleotide sequence shown in SEQ ID NO.4, and the kit includes the pair of primers and the probe. The kit of the present invention can not only detect type I bovine herpes virus rapidly, accurately and specifically, but also can effectively distinguish type I bovine herpes virus wild strain and type I bovine herpes virus gE gene-deleted vaccine strain. High specificity, good repeatability, and broad application prospects.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a primer pair, a probe, a kit and a method for detecting type I bovine herpes virus. Background technique [0002] Type I bovine herpesvirus (Bovine herpesvirus 1, BHV-1), also known as infectious rhinotracheitis virus (Infectious bovine rhinortracheitis virus, IBRV), mainly causes acute heat contact infection in cattle and causes infectious necrotizing rhinitis (ie " Red Nose"). The disease can lead to the reduction of the body's cellular immune function and immunosuppression, and it is easy to cause secondary infection. It is mainly transmitted through the air, vectors or direct contact with sick cattle. It is highly contagious and has a great impact on milk production, breeding and service. . [0003] Bovine herpes virus infection is widespread in the world, especially in areas where the cattle industry is more developed, and the epidemic trend is becoming...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/705C12Q1/6851C12Q2600/166C12Q2531/113C12Q2545/113C12Q2561/101
Inventor 张晓锋范红结翁永刚陈冈李守富郭海叶结平陈鸿军王中华
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products