Primer pair, probe, kit and method for detecting I-type bovine herpes virus
A bovine herpes virus and primer pair technology, applied in the field of bioengineering, can solve the problems of poor specificity, time-consuming, poor sensitivity, etc., and achieve the effects of optimized reaction conditions, broad application prospects, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0026] Example 1 Establishment of TaqMan probe fluorescence quantitative PCR detection method for type I bovine herpes virus gE gene
[0027] 1. Method
[0028] 1.1 Standard quality particle construction and primer and probe design
[0029] Using the full genome sequence of the BHV-1Cooper strain (accession number: KU198480.1), the gE gene sequence 1607-1704bp specific region sequence gtcgctctgggttcaaagtttggtttagggacccgcttgaagacgatgccgcgccagcgc ggaccccggccgcaccagattacaccgtggtagcagcg (SEQ ID NO: KU198480.1) was selected to construct the plasmid pegccggccgcaccagattacaccgtggtagcagcg (SEQ ID NO: 57) Standard product sequence. At the same time, the conserved and specific regions were selected to design primers and probes through BLAST comparison analysis. The primers and TaqMan probes were designed at the 1607-1704bp position of the gE gene sequence of the BHV-1Cooper strain as follows:
[0030] qBHV-gE-1607F: 5'-GTCGCTCTGGGTTCAAAGT-3' (SEQ ID NO. 1);
[0031] qBHV-gE-1704R: 5'-GCTGCTACCAC...
Example Embodiment
[0051] Example 3 Detecting clinical samples by using the TaqMan probe fluorescence quantitative PCR detection method of type I bovine herpes virus gE gene established in the present invention
[0052] 1. Clinical sample testing
[0053] Select 4 dairy farms in Table 2, collect 500 nasal cotton swabs and 100 vaginal secretions, and use the fluorescent quantitative PCR method of Example 1 to carry out BHV-1 detection.
[0054] Table 2 Sample collection
[0055]
[0056] 2. Test results
[0057] After real-time PCR detection by TaqMan probe method, it was found that the positive number of nasal cotton swab samples collected by 3 small dairy farms was relatively small (1% -1.5%), while the positive rate of large farms reached 20% (see table 3). In vagina swabs, the positive rate of large farms is as high as 30%, and the number of positives in small dairy farms is between 0-5%, which is significantly lower than that of large farms (P <0.01). This shows that both the respiratory tract type...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2023 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap