PRP8 nucleic acid molecules to control insect pests
A molecular and pest technology, applied in the field of genetic control, can solve problems such as inability to accurately identify effective targets a priori
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0245] Example 1: Materials and Methods
[0246] Sample preparation and bioassays
[0247] use The T7 RNAi Kit (LIFE TECHNOLOGIES, Carlsbad, CA) or the T7 Fast High Yield RNA Synthesis Kit (NEW ENGLAND BIOLABS, Whitby, Ontario) synthesized and purified a number of dsRNA molecules (including those corresponding to: prp8-1reg1 (SEQ ID ID 1). NO:5), prp8-2reg1 (SEQ ID NO:6), prp8-3reg1 (SEQ ID NO:7), prp8-3v1 (SEQ ID NO:8) and prp8-3v2 (SEQ ID NO:9)). Purified dsRNA molecules were prepared in TE buffer, which all bioassays consisted of a control treatment that served as a background check for mortality or growth inhibition of WCR (Ceratocystis cinerea). Using NANODROP TM An 8000 spectrophotometer (THERMO SCIENTIFIC, Wilmington, DE) measures the concentration of dsRNA molecules in the bioassay buffer.
[0248] The samples were tested for insect activity in a bioassay using newborn insect larvae fed an artificial insect diet. WCR eggs were obtained from CROP CHARACTERISTICS, ...
Embodiment 2
[0259] Example 2: Identification of candidate target genes
[0260] Insects from multiple WCR (Corn root beetle) developmental stages were selected for pooled transcriptome analysis to provide candidate target gene sequences controlled by RNAi transgenic plant insect protection techniques.
[0261] In one example, total RNA was isolated from approximately 0.9 g of whole first instar WCR larvae (4 to 5 days post hatch; maintained at 16°C) and phenol / TRI based using the following The method of purification (MOLECULAR RESEARCH CENTER, Cincinnati, OH):
[0262] The larvae were placed in a 10 mL Homogenize in a 15 mL homogenizer until a homogeneous suspension is obtained. After 5 minutes of incubation at room temperature, the homogenate was dispensed into 1.5 mL microcentrifuge tubes (1 mL per tube) and the mixture was shaken vigorously for 15 seconds after the addition of 200 [mu]L of chloroform. After allowing the extraction process to stand at room temperature for 10 minute...
Embodiment 3
[0273] Example 3: Amplification of target genes to generate dsRNA
[0274] Full-length or partial cloning of the sequence of the Beetle candidate gene (referred to herein as prp8) was used to generate PCR amplicons for dsRNA synthesis. Primers were designed to amplify the coding region portion of each target gene by PCR. See Table 1. Where appropriate, the T7 phage promoter sequence (TTAATACGACTCACTATAGGGAGA; SEQ ID NO: 10) was incorporated into the 5' end of the amplified sense or antisense strand. See Table 1. use (Life Technologies, Grand Island, NY) extracted total DNA from WCR and then used total DNA using The first strand synthesis system and the manufacturer's oligo dT priming instructions (Life Technologies, Grand Island, NY) were used to make the first strand cDNA. The first-strand cDNA is used as a template for a PCR reaction that employs reverse-positioned primers to amplify all or part of the native target gene sequence. The dsRNA was also amplified fr...
PUM
| Property | Measurement | Unit |
|---|---|---|
| length | aaaaa | aaaaa |
| length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More