Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing CD13 knockout porcine fibroblast and gene-edited pig

A fibroblast, gene knockout technology, applied in the field of gene editing, can solve the problems of not being effectively controlled, economic losses in the pig industry, losses in the pig industry, etc., to improve the efficiency of knockout, high accuracy, and reduce operation effect of difficulty

Pending Publication Date: 2018-04-10
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the end of 2010, porcine epidemic diarrhea broke out on a large scale in my country's pig farms, and it has not been effectively controlled in recent years, causing huge losses to my country's pig industry
Porcine epidemic diarrhea caused by PEDV has caused huge economic losses to the pig industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing CD13 knockout porcine fibroblast and gene-edited pig
  • Method for preparing CD13 knockout porcine fibroblast and gene-edited pig
  • Method for preparing CD13 knockout porcine fibroblast and gene-edited pig

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of the CRISPR / Cas9 targeting vector targeting the CD13 gene

[0037] 1. First lock the exon of the porcine CD13 gene as the targeting region, and design multiple targeting sites (gRNA) through software, and their sequences are target sequence 1: gcatcctcctcggcgtgg (SEQ ID NO: 1); target sequence 2: caagggattctacatttcca (SEQ ID NO: 2); Target sequence 3: ttctacatttccaaggccct (SEQ ID NO: 3).

[0038] 2. Synthesize complementary paired oligonucleotides according to the gRNA sequence, as shown in the table below, the lowercase letters are restriction sites.

[0039] Table 1 Oligonucleotides complementary to gRNA sequences

[0040]

[0041]

[0042] 3. The constructed CRISPR / Cas9 targeting vector targeting the CD13 gene, the pX330 vector backbone is as follows: figure 1 As shown, the specific construction method is as follows:

[0043] (1) Treat the synthesized oligonucleotide at 98° C. for 10 minutes, and then anneal it under natural cooling ...

Embodiment 2

[0048] Example 2 Establishment of Large White Pig Fetal Fibroblast Cell Line with Gene Knockout of CD13 Gene

[0049] 1. Cell transfection

[0050] The day before the transfection, the primary large white pig fetal fibroblasts were resuscitated into a 6cm plate, and the cells could be transfected when the cells reached 70-80% confluence. The transfection step was performed strictly according to the instructions of the Basic Primary Fibroblasts Nucleofector Kit (Lonza).

[0051] 2. Detection of target shooting efficiency

[0052] After the electrotransfected cells were cultured for 48 hours, some of them were used for plating, and some of the cells were collected to extract the cell genome and perform PCR amplification to detect the targeting efficiency. The results showed that the target sequence 1 (SEQ ID NO: 1) target The efficiency was as high as 17%, while the targeting efficiencies of target sequences 2-3 (SEQ ID NO: 2-3) were 12% and 7%, respectively. Among them, targ...

Embodiment 3

[0067] Example 3 Method for preparing genome-edited pigs resistant to epidemic diarrhea virus by somatic cell nuclear transfer technology

[0068] The homozygous knockout positive cells obtained in Example 2 were used as nuclear transfer donor cells, and young pig oocytes matured in vitro for 40 hours were used as nuclear transfer recipient cells, and the nuclear transfer donor cells were transferred into enucleated oocytes , After electric fusion and activation, recombinant cloned embryos were constructed, and the cloned recombinant embryos with good development status were selected and transferred into the uterus of natural estrous large white sows for pregnancy. Surgical method The procedure of embryo transfer is ventilator anesthesia, accompanied by 2% chloral hydrate to maintain anesthesia, lying supine on the surgical rack, making a surgical incision about 10 cm long in the midline of the abdomen, exposing the ovaries, fallopian tubes and uterus, and using embryo transfer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a gene knockout vector, a method for preparing a CD13 knockout porcine fibroblast or gene-edited pig, and the CD13 knockout porcine fibroblast prepared by the method. The gene knockout vector includes a gene editing vector backbone and a DNA segment linked to the vector backbone, and the vector backbone is selected from CRISPR / Cas9, CRISPR / Cas9n, CRISPR / Cpf1 or CRISPR / C2c2. The nucleotide sequence of the DNA segment is as shown in any one of SEQ ID NO: 1, SEQ ID NO:2 and SEQ ID NO: 3, preferably as shown in the SEQ ID NO:1. CD13 gene can be rapidly and accuratelyknocked out by the gene knockout vector and the method to obtain the CD13 gene homozygous knockout porcine fibroblast and gene-edited pig without an exogenous marker gene, a research platform is provided for porcine epidemic diarrhea, and the CD13 gene homozygous knockout porcine fibroblast and gene-edited pig have very high breeding value for disease resistance.

Description

technical field [0001] The invention relates to the field of gene editing, in particular to a method for preparing CD13 gene knockout porcine fibroblasts and gene editing pigs. Background technique [0002] Porcine epidemic diarrhea (PED) is a highly contagious enteric disease caused by porcine epidemic diarrhea virus (PEDV). Pigs of any age can be infected, especially for piglets, and the mortality rate is very high, especially for newborn piglets within 7 days of age, in the absence of effective maternal antibodies, the mortality rate can be as high as 100%; for adult pregnant sows For example, reproductive performance is affected after infection. For example, sows in early pregnancy will suffer abortion after infection, and the pregnancy rate will decrease; fattening pigs will lose weight after infection. [0003] Currently, although there is a commercial porcine epidemic diarrhea virus vaccine, porcine epidemic diarrhea virus and porcine transmissible gastroenteritis (T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N9/22C12N5/10A01K67/027
CPCA01K67/0275A01K2217/075A01K2227/108A01K2267/0337C12N9/22C12N15/907
Inventor 刘志国牟玉莲李奎李巨浪
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com