A kind of rice blast resistance locus pi2/9 functional gene molecular marker and its application
A technology of functional genes and molecular markers, applied in the field of agricultural biology, can solve problems such as identification of unsuitable germplasm resources or screening of resistant resources, and achieve the effects of low cost, high accuracy and strong operability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: rice blast resistance loci Pi2 / 9 Functional gene-specific molecular markers and their primer design and detection
[0036] (1) Pi2 / 9 Analysis of functional polymorphisms in gene clusters:
[0037] Downloaded from public database Pi2, Piz-t, Pi9 and Pigm The genome sequence of the genome sequence and the genome sequence of the corresponding region of the sequenced variety Nipponbare, for Pi2 / 9 Sequence comparison and screening of functional genes Pi2 / z-t, Pi9 and Pigm A specific, differential site that can be distinguished from the allele of the site. gene-specific Pi2, Piz-t, Pi9 and Pigm The results of the multiple sequence alignment are shown in the table below:
[0038] Pi2 / z-t:
[0039] II: CTTATTTCGTTTGCTATGCGCAGTTGCGCACCAACCGTTTGCTAGAATGTCTGAAAGAGCCTATGTACATATGGTGGCCTGAACATTACAAGTTATCATATTTTATATTGTTGCTAGCTT TCCTTTC AA / A AAAAAAAAAAAATTGTTCCTAACCGATCACATAGTCC;
[0040] Pi9:
[0041] I: CTTATTTCGTTTGCTATGAGCACCAATCGTTTGCTAGAA...
Embodiment 2
[0064] Example 2: Resistance loci Pi2 / 9 Functional gene-specific molecular markers in the identification of Pi2 / 9 Application of different rice blast resistance genes in gene cluster regions.
[0065] According to the polymorphic PCR product bands, the target gene can be Pi2, Piz-t, Pi9 and Pigm respectively from Pi2 / 9 identified in gene clusters. Such as figure 1 As shown, depending on the presence of stripes, the Pi2, Piz-t, Pi9 and Pigm Distinguished from other alleles identified at this locus, 132bp and 164bp indicate that they contain Pigm Gene, 165bp and 166bp means containing Pi2 / z-t Resistance gene, 132bp means containing Pi9 Resistance gene, no band means no functional gene of this site. It can be seen that the test results are consistent with the design analysis, indicating that the resistance loci Pi2 / 9 Functional gene-specific molecular markers can be identified in Pi2, Piz-t, Pi9 and Pigm etc. have been applied.
Embodiment 3
[0066] Example 3: Resistance loci Pi2 / 9 Application of Functional Gene Specific Molecular Markers in Other Rice Varieties
[0067] Select 92 representative rice varieties, in order: Gufeng A, Ezao 11, Minhui 3119, Xin 1223, Y58s, Zhongsi B, Xiangzaoxian 45, Zhongzao 23, 618B, Yixiang 1B, Huaxiang B , II-32B, 629B, 2155, Wufeng B, Huifeng B, Anfeng B, Longtepu B, Jinkang 1B, Taifeng B, Tianfeng B, IR88988B, Guangkang 13B, Zhenshan 97B, Jin 23B . , Gang 46B, Fengyuan B, D702B, Minghui 86, R1128, Kongyu 131, Xiangzaoxian 7, Zhonghui 8015, Yinzhan, Guangchao 128, Xiaozhan, Huanghuazhan, Zhongxiang 1, Zhongjian 100 . IR661-1, Nanjing 11, Gui 630, Aituogu 151, Xiangwanxian 1, Dongting late Xianxian, Yangdao 2, Zhongnong 4, Guanghui 128, Teqingxuan, Ce 64, Wan 3, R527 , Guanghui 998, Lehui 188, Shuhui 881, Duoxi No. 1, Shuhui 498, Minghui 72, Luhui 17, Yanhui 559, Fuhui 838, Jiangyouhui 151, Kangmoqingzhan, Gui 99, Chenghui 448, Fuhui 718.
[0068] Genomic DNA was extracted res...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com