Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of rice blast resistance locus pi2/9 functional gene molecular marker and its application

A technology of functional genes and molecular markers, applied in the field of agricultural biology, can solve problems such as identification of unsuitable germplasm resources or screening of resistant resources, and achieve the effects of low cost, high accuracy and strong operability

Active Publication Date: 2021-03-26
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, they are only suitable for some parents and are not suitable for identification of germplasm resources or screening of resistance resources.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of rice blast resistance locus pi2/9 functional gene molecular marker and its application
  • A kind of rice blast resistance locus pi2/9 functional gene molecular marker and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: rice blast resistance loci Pi2 / 9 Functional gene-specific molecular markers and their primer design and detection

[0036] (1) Pi2 / 9 Analysis of functional polymorphisms in gene clusters:

[0037] Downloaded from public database Pi2, Piz-t, Pi9 and Pigm The genome sequence of the genome sequence and the genome sequence of the corresponding region of the sequenced variety Nipponbare, for Pi2 / 9 Sequence comparison and screening of functional genes Pi2 / z-t, Pi9 and Pigm A specific, differential site that can be distinguished from the allele of the site. gene-specific Pi2, Piz-t, Pi9 and Pigm The results of the multiple sequence alignment are shown in the table below:

[0038] Pi2 / z-t:

[0039] II: CTTATTTCGTTTGCTATGCGCAGTTGCGCACCAACCGTTTGCTAGAATGTCTGAAAGAGCCTATGTACATATGGTGGCCTGAACATTACAAGTTATCATATTTTATATTGTTGCTAGCTT TCCTTTC AA / A AAAAAAAAAAAATTGTTCCTAACCGATCACATAGTCC;

[0040] Pi9:

[0041] I: CTTATTTCGTTTGCTATGAGCACCAATCGTTTGCTAGAA...

Embodiment 2

[0064] Example 2: Resistance loci Pi2 / 9 Functional gene-specific molecular markers in the identification of Pi2 / 9 Application of different rice blast resistance genes in gene cluster regions.

[0065] According to the polymorphic PCR product bands, the target gene can be Pi2, Piz-t, Pi9 and Pigm respectively from Pi2 / 9 identified in gene clusters. Such as figure 1 As shown, depending on the presence of stripes, the Pi2, Piz-t, Pi9 and Pigm Distinguished from other alleles identified at this locus, 132bp and 164bp indicate that they contain Pigm Gene, 165bp and 166bp means containing Pi2 / z-t Resistance gene, 132bp means containing Pi9 Resistance gene, no band means no functional gene of this site. It can be seen that the test results are consistent with the design analysis, indicating that the resistance loci Pi2 / 9 Functional gene-specific molecular markers can be identified in Pi2, Piz-t, Pi9 and Pigm etc. have been applied.

Embodiment 3

[0066] Example 3: Resistance loci Pi2 / 9 Application of Functional Gene Specific Molecular Markers in Other Rice Varieties

[0067] Select 92 representative rice varieties, in order: Gufeng A, Ezao 11, Minhui 3119, Xin 1223, Y58s, Zhongsi B, Xiangzaoxian 45, Zhongzao 23, 618B, Yixiang 1B, Huaxiang B , II-32B, 629B, 2155, Wufeng B, Huifeng B, Anfeng B, Longtepu B, Jinkang 1B, Taifeng B, Tianfeng B, IR88988B, Guangkang 13B, Zhenshan 97B, Jin 23B . , Gang 46B, Fengyuan B, D702B, Minghui 86, R1128, Kongyu 131, Xiangzaoxian 7, Zhonghui 8015, Yinzhan, Guangchao 128, Xiaozhan, Huanghuazhan, Zhongxiang 1, Zhongjian 100 . IR661-1, Nanjing 11, Gui 630, Aituogu 151, Xiangwanxian 1, Dongting late Xianxian, Yangdao 2, Zhongnong 4, Guanghui 128, Teqingxuan, Ce 64, Wan 3, R527 , Guanghui 998, Lehui 188, Shuhui 881, Duoxi No. 1, Shuhui 498, Minghui 72, Luhui 17, Yanhui 559, Fuhui 838, Jiangyouhui 151, Kangmoqingzhan, Gui 99, Chenghui 448, Fuhui 718.

[0068] Genomic DNA was extracted res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a functional gene molecular marker of a rice blast resistance locus Pi2 / 9 and application thereof. The molecular marker of a specific band type for rice blast resistance genes Pi2, Piz-t, Pi9 and Pigm is amplified from rice genome DNA by virtue of a primer pair SEQ ID NO.1-2. The functional gene specific molecular marker of the rice blast resistance locus Pi2 / 9 has importantapplication value, and utilization efficiency of the gene in germplasm resource screening, molecular marker-assisted selective breeding, gene pyramiding breeding and transgenic breeding can be increased by utilizing the marker.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, in particular to a rice blast resistance locus Pi2 / 9 Functional gene-specific molecular markers and their applications. Background technique [0002] by Magnaporthe grisea ( Magnapothe oryzae ) caused by rice blast is the most important disease of rice, which will cause serious losses to the main rice producing areas in the world. Due to the frequent pathogenic variation of rice blast physiological races, most resistant varieties will gradually lose resistance within 3 to 5 years of planting; therefore, identifying and rationally utilizing broad-spectrum resistance genes is an important way for disease-resistant varieties. In recent years, with the fine mapping or cloning of multiple rice blast resistance genes and the development and application of molecular markers, the identification of resistance genes and the development of multi-resistance gene aggregation breeding have been pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 田大刚王锋陈松彪林艳陈子强陈在杰杨立明胡昌泉
Owner BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com