Application of nitrate transportation gene OsNRT1.9b in selective breeding of paddy rice

A technology of osnrt1.9b and gene, applied in application, genetic engineering, recombinant DNA technology, etc., to achieve the effect of enhancing tillering ability and increasing yield

Active Publication Date: 2018-05-15
WUHAN INST OF BIOENG
View PDF8 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the research of NPF family members. The OsNRT1.9 gene involved in the present invention is a nitrate transport homologous gene of rice NPF gene family

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of nitrate transportation gene OsNRT1.9b in selective breeding of paddy rice
  • Application of nitrate transportation gene OsNRT1.9b in selective breeding of paddy rice
  • Application of nitrate transportation gene OsNRT1.9b in selective breeding of paddy rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Construction of embodiment 1 OsNRT1.9b gene overexpression plant

[0024] Extract the RNA of rice Zhonghua 11 and reverse transcribe it into cDNA, using the primer pair:

[0025] F1: 5'- AGATCT ATGCAGGATGTAGGTTCAGAATAC-3' (Bgl II),

[0026] R1: 5'- CTTAAG TCACTGCGACAGCGCCAAGCACGA-3' (Afl II);

[0027] After the cDNA of the OsNRT1.9b gene was amplified by PCR, it was digested with Bgl II and Afl II and then ligated into the pCAMBIA-1301 vector (the pCAMBIA-1301 vector was purchased from Cambia Company) to construct the overexpression vector OsNRT1 of the OsNRT1.9b gene. 9b-p1301. Using the genetic transformation method mediated by Agrobacterium EHA105, the overexpression vector was introduced into the normal rice variety Zhonghua 11.

[0028] Transplant all the obtained transgenic seedlings into baskets with soil, water and fertilize them regularly, and plant them in the field when the seedlings grow about 10cm in height. After the seedlings grow up, extract genomic...

Embodiment 2

[0032] The acquisition of embodiment 2 OsNRT1.9b gene mutant plant

[0033] F3: ACACTTATTGGGGCAGATAC TGG ,

[0034] F4: ATCGTTCCGTAGTGTATCTA GGG .

[0035] Using the above two target sequences, the gene knockout vector OsNRT1.9b-C of the OsNRT1.9b gene was constructed (for the method, refer to Ma X et al, A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015, 8(8):1274-1284). The genetic transformation method mediated by Agrobacterium EHA105 was used to introduce the gene knockout expression vector into the normal japonica rice variety Zhonghua 11. The mutant plants were sequenced in the T0 generation, and it was determined that the gene had been knocked out, and continued to breed until the T1 generation, that is, the mutant plants of the OsNRT1.9b gene were obtained. The number of tillers in the OsNRT1.9b gene mutant plants was far less than that of the control Zhonghua 11 plants, and the diff...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a nitrate transportation gene OsNRT1.9b in selective breeding of paddy rice and belongs to the field of plant gene engineering. The amino acid sequence of a protein encoded by the OsNRT1.9b gene is represented as the SEQ ID No.1 while the cDNA sequence is represented as the SEQ ID No.2. In the invention, by constructing an OsNRT1.9b gene overexpression plant and an OsNRT1.9a gene mutant plant of paddy rice, it is found that by increasing the expression of the OsNRT1.9b gene, normal tiller number and single-plant ear number of paddy rice are increased,and grain filling number and productivity of single plant are increased, so that the OsNRT1.9b gene can be used in selective breeding of the paddy rice so as to increase the yield thereof. The OsNRT1.9b gene has significant application value in the aspect of expounding influence of nitrogen on growth and development process of plants and improvement on plant type of the paddy rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of a nitrate transport gene OsNRT1.9b in rice breeding. Background technique [0002] China's rice planting area accounts for 20% of the world's total crop planting area, but nitrogen fertilizer application accounts for 37% of the world's total application amount; in 1995, China's nitrogen fertilizer production and use amount reached the first in the world, but nitrogen fertilizer use efficiency is low Low, the amount of nitrogen fertilizer application has increased by 20 times compared with 50 years ago. According to this trend, it is expected to triple again by 2050. Excessive application of nitrogen fertilizer will lead to ecological pollution such as eutrophication of water [Xu Guohua, Fan Xiaorong. Functional study of rice nitrate transporter genes OsNRT1.1b and OsNRT1.1b. Nanjing Agricultural University, 2011: 4-6]. More nitrogen nutrien...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00A01H6/46A01H6/82A01H6/00C07K14/415
CPCC07K14/415C12N15/8261
Inventor方中明黄玮婷汪杰朱炜吕凯
OwnerWUHAN INST OF BIOENG