Improved promoter, T vector composed of improved promoter and application of improved promoter

A technology of promoters and recombinant vectors, which is applied in the field of genetic engineering, can solve the problems that T vectors cannot be cloned, and achieve the effect of avoiding the defects of false positive clones, false positives and false negatives

Active Publication Date: 2018-05-22
GENEWIZ INC SZ
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, the technical problem to be solved in the present invention is to overcome that the T vector prepared in the prior art cannot be cloned, or produce a large number of false positive or false negative clones, thereby providing an improved promoter and the T vector of its composition and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved promoter, T vector composed of improved promoter and application of improved promoter
  • Improved promoter, T vector composed of improved promoter and application of improved promoter
  • Improved promoter, T vector composed of improved promoter and application of improved promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1: Codon optimization lacZα gene

[0086] Codon optimization of the lacZα gene includes the following steps:

[0087] The lacZα gene of pUC57 (SEQ ID NO.36) was optimized with codon optimization software (Codon optimization software, developed by Suzhou Jinweizhi Biotechnology Co., Ltd.), and the optimized lacZα gene was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. , The nucleotide sequence is shown in SEQ ID No. 36, specifically as follows:

[0088] lacZα gene (SEQ ID NO.36): ATGACCATGCTCGAGCCAAGCTTGCATGCAGGCCTCTGCAGTCGACGGGCCCGGGATCCGATATCTAGATGCATTCGCGAGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG;

[0089] LacZα optimized gene (SEQ ID NO.37): ATGACCATGCTGGAACCGAGCCTGCATGCAGGTCTGTGCAGCCGTCGTGCACGCGATCCGATTAGCCGCTGCATTCGCGAAGTGCCGAGCAGCAA...

Embodiment 2

[0090] Example 2: Construction of high-copy cloning vector

[0091] The construction method of high-copy cloning vector includes the following specific steps:

[0092] I) Replace the lacZα gene of pUC57 (kanamycin resistance) with the optimized lacZα gene in Example 1, as follows:

[0093] (1) Use the kanamycin-resistant plasmid pUC57 as a template and use SEQ ID NO.38-39 as primers for PCR amplification. The specific sequence is as follows:

[0094] SEQ ID NO.38 (forward primer): ATGCAGGCTCGGTTCCAGCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCC;

[0095] SEQ ID NO.39 (reverse primer): AGCACCATTTGCAGCGATGCCGCCTAATTAAGCCAGCCCCGACACCCGCCAACAC;

[0096] The PCR reaction system is shown in Table 1 below:

[0097] Table 1

[0098]

[0099] Among them, a set of negative controls with water as the sample;

[0100] The reaction conditions are shown in Table 2 below:

[0101] Table 2

[0102]

[0103]

[0104] (2) The PCR reaction solution obtained in step (1) is subjected to 1% agarose gel electrophoresis and ...

Embodiment 3

[0153] Example 3 Experimental verification that the cloning vector of the present invention overcomes false positive cloning

[0154] Construction of pUC57-lacZ-Mu-2-T-Mim-1, pUC57-lacZ-Mu-2-T-Mim-2, pUC57-lacZ-Mu-2-T-Mim-3 plasmids to simulate pUC57-lacZ-Mu- The 2-T vector lacks 1-2 bases at both ends of the restriction site and self-ligates. The construction steps are as follows:

[0155] (1) Using the plasmid pUC57-lacZ-Mu-2-T constructed in Example 2 as the template, using F-MU-1+R-MU-1, F-MU-2+R-MU-2, F -MU-3+R-MU-3 are primers for PCR amplification reaction, the primers F-MU-1, R-MU-1, F-MU-2, R-MU-2, F-MU-3 The nucleotide sequence of R-MU-3 is shown in SEQ ID NO.44-SEQ ID NO.49, and the details are as follows:

[0156] SEQ ID NO.44 (F-MU-1): CGAGCCGGAGAATCAAGTGTAAAGCCTGGGGTGCCTAATGAG;

[0157] SEQ ID NO.45 (R-MU-1): CAGGCTTTACACTTGATTCTCCGGCTCGTATGTTGTGTGGAATTGTG;

[0158] SEQ ID NO.46 (F-MU-2): TACGAGCCGGAGATTCAAGTGTAAAGCCTGGGGTGCCTAATGAG;

[0159] SEQ ID NO. 47 (R-MU-2): GGCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and relates to an improved promoter and application of the improved promoter. According to the improved promoter, a nucleic acid sequence between a -35 zone and a -10 zone in the promoter is mutated into an endonuclease recognition site. By adopting the improved promoter, the problems that a vector obtained blue-white selection is adopted and has a transcription or translation product obtained by promoting an exogenous gene through a strong promoter, so that toxicity to a host is possibly caused and the host cannot be cloned are solved,and the defect that a lacZalpha gene has frameshift mutation to generate false positive cloning, caused by the fact that 1-2bp of the vector is deleted at an enzyme digestion site can be avoided; a condition that an exogenous DNA (Deoxyribonucleic Acid) segment is relatively small and a reading frame of the lacZalpha gene is not changed when exogenous DNA is inserted so that a false negative phenomenon that locus ceruleus is fully distributed on a flat plate can be eliminated.

Description

Technical field [0001] The present invention belongs to the field of genetic engineering, and relates to an improved promoter and a T vector composed of it and its application, in particular to an improved promoter, a T vector with the improved promoter, and a T vector with the T vector Host cells and their applications. Background technique [0002] The invention of PCR technology is a major breakthrough in the field of molecular biology and genetic engineering. After the birth of PCR technology, the technology of cloning PCR products into vectors (usually plasmids) has also been developed. Commonly used and relatively simple cloning methods include TA cloning and blunt-end ligation. The PCR product amplified by the Taq enzyme contains a dAMP tail. Under the action of T4 ligase, it can be ligated with a vector containing a T terminal (T vector). This is a TA clone. High-fidelity DNA polymerases usually contain 3'-5' exonuclease activity, and the PCR products they amplify have...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/70C12N15/66C12N1/21C12R1/19
CPCC12N9/2465C12N15/66C12N15/70C12N2800/22C12Y302/01022
Inventor薛高旭谢正立冯爱华齐甜铭贾延凯吴昕孙中平廖国娟
OwnerGENEWIZ INC SZ