Immortalized urine-source cell strain and building method thereof

A construction method and cell line technology are applied in the field of immortalized urine-derived cell lines and their construction, which can solve the problems that the biological sample bank is not fully perfected and needs to be improved.

Pending Publication Date: 2018-05-25
OSINGLAY BIO PHARM CO LTD +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with European countries, my country's biological sample bank is not yet perfect and needs to be improved
At present, there is no establishment of related cell banks for immortalized urine-derived cell lines, and the acquisition of urine-derived cells is more convenient than other cells and has the characteristics of no trauma to the donor. Therefore, constructing a urine-derived cell line The cell bank of cell lines and the corresponding STR typing and HLA typing of the cells entering the bank, and the establishment of cell information files that can be tested, that is, the urine-derived cell bank, are very important for improving the construction of my country's biological sample bank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immortalized urine-source cell strain and building method thereof
  • Immortalized urine-source cell strain and building method thereof
  • Immortalized urine-source cell strain and building method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Collection and culture of primary urine-derived cells

[0050] Collect 10ml-2L of urine, centrifuge (1010g, 5min) to discard the supernatant, resuspend the pellet with PBS containing double antibody and centrifuge again to discard the supernatant, and then resuspend the pellet to the cells with urine-derived cell culture medium Culture plate (24-well plate), and add 100μg / ml primocin, then place it at 37℃, 5% CO 2 Cultivation is carried out in the cell incubator, during which no other operations will be performed, and the medium will be changed after 5 days, and the cell clones will grow to a certain size for digestion and passage. The morphology of the primary urine-derived cells collected from the culture is as figure 1 As shown, figure 1 Middle A is the adherent state of urine-derived cells observed under a microscope on the 5th day of culture, figure 1 Middle B is the cell morphology of urine-derived cells collected and cultured to the 12th day. It can be see...

Embodiment 2

[0052] Example 2. Construction of immortalized urine-derived cell lines

[0053] Methods of introducing foreign genes or DNA fragments into cells and integrating them into the cell genome include methods using gene editing, lentiviral vectors, retroviral vectors, and the like.

[0054] 1) Gene editing method

[0055] 1.1) Find out the specific target sgRNA

[0056] sgRNA-AAVS1-1: 5'TATAAGGTGGTCCCAGCTCG 3'(SEQ ID NO: 1);

[0057] sgRNA-AAVS1-2: 5'AGGGCCGGTTAATGTGGCTC 3'(SEQ ID NO: 2).

[0058] 1.2) Construct sgRNA into the vector plasmid gRNA Cloning Vector

[0059] 1.2.1) Vector preparation: AflII digests gRNA Cloning Vector (Plasmid 41824, Adegene), then uses mung bean nuclease (#M0250S, NEB) to eliminate overhangs, and finally dephosphorylates the ends of the vector.

[0060] 1.2.2) Design and prepare annealed fragments of sgRNA

[0061] sgRNA-AAVS1-1: 5'TATAAGGTGGTCCCAGCTCG 3'(SEQ ID NO: 1);

[0062] ①. Clone-sgRNA-AAVS1-1-a: 5'TTGTGGAAAGGACGAAACACCGTATAAGGTG 3'(SEQ IDNO: 3);

[0063] ②. C...

Embodiment 3

[0112] Example 3. Monoclonal culture of immortalized urine-derived cell lines

[0113] The immortalized urine-derived cell lines GE-HUC, LV-HUC, and RV-HUC constructed in the foregoing Example 2 were cultured in single-cell clones respectively.

[0114] 1) Digest the immortalized urine-derived cell line cultured to the 4th generation with trypsin to a single cell, centrifuge to discard the supernatant after the medium is terminated, and resuspend in the medium for counting, and dilute the cells to 500 cells / ml, suspend 0.2ml in 15ml culture medium, seed the plate with a row gun, and add 150μl cell suspension to each well of the 96-well plate.

[0115] 2) After 2 hours, when the cells adhere to the wall, observe under the microscope, and note the position of the hole with only one cell.

[0116] 3) Observe the marked wells under the microscope after 24 hours, and confirm that the wells with only one clone are single-cell clones.

[0117] 4) Observe single-cell clones every day, change ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an immortalized urine-source cell strain and a building method thereof and belongs to the technical field of biology. The immortalized urine-source cell strain is obtained by transfecting recombinant plasmids carrying immortalization genes or DNA fragments into urine-source cells. The inventor transfects the SV40LT recombinant plasmids into the urine-source cells to build the immortalized urine-source cell strain. A safe and reliable gene editing method is optimally selected by comparison to obtain the immortalized urine-source cell strain. When the immortalized urine-source cell strain is cultured to the 35th generation, cells are quite young and do not have an evident aging phenomenon; cells are increased logarithmically, and the cell proliferation rate is three times of that of primary-generation urine-source cells which are cultured to the 4th generation. Identification and analysis show that various indexes of the immortalized urine-source cell strain are normal. The cell attachment rate of the immortalized urine-source cell strain recovered after one month of freeze preservation reaches up to 95%, and long-term stable growth and passage can be achieved.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to an immortalized urine-derived cell strain and a construction method thereof. Background technique [0002] A large number of existing studies have shown that due to the influence of dietary habits and social environment, many diseases of the urinary tract system (including the bladder and kidneys) occur in contemporary people, and kidney-related diseases such as chronic renal glomerulonephritis, pyelonephritis, nephrotic syndrome, Acute renal failure, high blood nephropathy, etc., and the bladder will be exposed to chemical substances such as benzidine due to occupational exposure and other factors to cause bladder tumors, and so on. Researchers conduct research on these diseases of the urinary tract system, usually by sampling biopsy to obtain the object of the study. This aggressive behavior can cause related trauma to the donor bladder or kidney and local tissue bleeding. ,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/85
CPCC12N5/0602C12N2510/00C12N2510/04C12N5/0684
Inventor王淋立关春燕陈月花张雁
OwnerOSINGLAY BIO PHARM CO LTD