Unlock instant, AI-driven research and patent intelligence for your innovation.

Tumor-driven gene mutation detection agent and detection kit and application thereof

A detection agent and gene technology, applied in the field of detection agent for tumor driver gene variation, can solve the problems of ineffective guidance of treatment of tumor patients, few tumor driver gene mutation forms, primer dimer, etc., to achieve fast detection speed and high sensitivity , the effect of simple operation

Inactive Publication Date: 2018-05-29
SHANGHAI TONGSHU BIOLOGY SCI & TECH CO LTD
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional detection methods or detection products can detect fewer mutation forms of tumor driver genes, and only one type of mutation can be detected at a time. When multiple gene mutation types are detected at one time, there are interactions between multiple primers or probes. Interference, leading to problems such as primer dimers and false positives, cannot effectively guide the treatment of tumor patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor-driven gene mutation detection agent and detection kit and application thereof
  • Tumor-driven gene mutation detection agent and detection kit and application thereof
  • Tumor-driven gene mutation detection agent and detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0307] Based on ARMS technology combined with MGB probes, specific primers and probes are designed and synthesized, and corresponding primers and probes are selected according to the types of detected genes and mutation sites. Among them, the primers and probes for tumor driver gene mutation are shown in Table 1, and the primers and probes for tumor driver gene fusion are shown in Table 2.

[0308] Table 1 Primers and probes for tumor driver gene mutations

[0309]

[0310]

[0311]

[0312]

[0313] Wherein, E13; A20 in Table 2 means that the No. 13 exon of ELM4 is fused with the No. 20 exon of ALK, and the others have similar meanings.

[0314] It has been verified that the lengths of the amplification products of the primers in Tables 1-2 are all 100bp-120bp, and the Tm values ​​are all in the range of 60°C-65°C, meeting the actual needs.

Embodiment 2

[0316] (1) According to the instructions of the AllPrep DNA / RNA / miRNA Universal Kit (QIAGEN Cat.No.80224), the DNA of the wild-type tissue sample was extracted to obtain the DNA of the wild-type tissue sample, which was diluted to 5 ng / μL. Wherein, the wild-type tissue sample is a normal tissue.

[0317] (2) Construct positive plasmids for HER2 gene mutation, MET-a positive plasmid, MET-b positive plasmid, KRAS gene mutation positive plasmid and BRAF gene mutation positive plasmid, according to the plasmid extraction kit (B518191, Shanghai Sheng Work) Instructions for use Extract the DNA in each positive plasmid to obtain HER2 mutation gene DNA, MET-a gene mutation DNA, MET-b gene mutation DNA, KRAS gene mutation DNA and BRAF gene mutation DNA, wherein the HER2 mutation gene DNA contains The c.2339_2340insGGGCTCCCC mutation type of the HER2 gene in Example 1, the MET-a gene mutation DNA contains the c.3028+1G>T mutation type of the MET gene in Example 1, and the MET-b gene mut...

Embodiment 3

[0326] (1) According to the operation in step (1) of Example 2, wild-type tissue sample DNA with a concentration of 5 ng / μL was obtained. Wherein, the wild-type tissue sample is a normal tissue.

[0327] (2) Construct a positive plasmid for HER2 gene mutation, and extract the DNA in the positive plasmid to obtain HER2 mutant gene DNA, wherein the HER2 mutant gene DNA contains 14 mutation types of the HER2 gene in Example 1. Qbuit was used to detect the quality and concentration of HER2 mutant gene DNA, wherein the concentration of each HER2 mutant gene DNA was 5 ng / μL.

[0328] (3) Using the corresponding 21 forward primers, 3 reverse primers and 3 probes in Table 1, and according to the operation of Example 2, quantitatively analyze the DNA of the above HER2 mutant gene, which is the HER2 experimental group. The first forward primer was replaced with a forward primer whose base sequence was CCAGTGGCCATCAAAGTGAA, and the others remained unchanged, and quantitative analysis wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a tumor-driven gene mutation detection agent and a tumor-driven gene mutation detection kit and application thereof. The tumor-driven gene mutation detection agent comprises an HER2 gene mutation detection agent, wherein the HER2 gene mutation detection agent comprises 21 positive primers, 3 negative primers and 3 probes. The tumor-driven gene mutation detection agent candetect multiple mutation types of an HER2 gene at a time, is relatively high in detection sensitivity, rapid in detection and simple in operation, and can meet the time requirement of clinical rapid detection.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a detection agent for tumor driver gene variation, a detection kit and an application thereof. Background technique [0002] Tumor is a disease with high morbidity and mortality, which seriously endangers public health. With the in-depth research on tumor pathogenesis and its biological behavior, more and more research focuses on tumor driver genes such as ALK gene, BRAF gene, and KRAS gene, and timely detection of mutations in these tumor driver genes is important for early diagnosis and treatment. It has important guiding significance for tumor screening and individualized treatment of cancer patients. [0003] However, the occurrence of tumors may be accompanied by mutations in a variety of tumor driver genes. At the same time, there are various forms of gene mutations in tumors, such as mutations or fusions. Traditional detection methods or detection products can detect fewer m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/156
Inventor 袁青蒋小琴严令华
Owner SHANGHAI TONGSHU BIOLOGY SCI & TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More