Tumor-driven gene mutation detection agent and detection kit and application thereof
A detection agent and gene technology, applied in the field of detection agent for tumor driver gene variation, can solve the problems of ineffective guidance of treatment of tumor patients, few tumor driver gene mutation forms, primer dimer, etc., to achieve fast detection speed and high sensitivity , the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0307] Based on ARMS technology combined with MGB probes, specific primers and probes are designed and synthesized, and corresponding primers and probes are selected according to the types of detected genes and mutation sites. Among them, the primers and probes for tumor driver gene mutation are shown in Table 1, and the primers and probes for tumor driver gene fusion are shown in Table 2.
[0308] Table 1 Primers and probes for tumor driver gene mutations
[0309]
[0310]
[0311]
[0312]
[0313] Wherein, E13; A20 in Table 2 means that the No. 13 exon of ELM4 is fused with the No. 20 exon of ALK, and the others have similar meanings.
[0314] It has been verified that the lengths of the amplification products of the primers in Tables 1-2 are all 100bp-120bp, and the Tm values are all in the range of 60°C-65°C, meeting the actual needs.
Embodiment 2
[0316] (1) According to the instructions of the AllPrep DNA / RNA / miRNA Universal Kit (QIAGEN Cat.No.80224), the DNA of the wild-type tissue sample was extracted to obtain the DNA of the wild-type tissue sample, which was diluted to 5 ng / μL. Wherein, the wild-type tissue sample is a normal tissue.
[0317] (2) Construct positive plasmids for HER2 gene mutation, MET-a positive plasmid, MET-b positive plasmid, KRAS gene mutation positive plasmid and BRAF gene mutation positive plasmid, according to the plasmid extraction kit (B518191, Shanghai Sheng Work) Instructions for use Extract the DNA in each positive plasmid to obtain HER2 mutation gene DNA, MET-a gene mutation DNA, MET-b gene mutation DNA, KRAS gene mutation DNA and BRAF gene mutation DNA, wherein the HER2 mutation gene DNA contains The c.2339_2340insGGGCTCCCC mutation type of the HER2 gene in Example 1, the MET-a gene mutation DNA contains the c.3028+1G>T mutation type of the MET gene in Example 1, and the MET-b gene mut...
Embodiment 3
[0326] (1) According to the operation in step (1) of Example 2, wild-type tissue sample DNA with a concentration of 5 ng / μL was obtained. Wherein, the wild-type tissue sample is a normal tissue.
[0327] (2) Construct a positive plasmid for HER2 gene mutation, and extract the DNA in the positive plasmid to obtain HER2 mutant gene DNA, wherein the HER2 mutant gene DNA contains 14 mutation types of the HER2 gene in Example 1. Qbuit was used to detect the quality and concentration of HER2 mutant gene DNA, wherein the concentration of each HER2 mutant gene DNA was 5 ng / μL.
[0328] (3) Using the corresponding 21 forward primers, 3 reverse primers and 3 probes in Table 1, and according to the operation of Example 2, quantitatively analyze the DNA of the above HER2 mutant gene, which is the HER2 experimental group. The first forward primer was replaced with a forward primer whose base sequence was CCAGTGGCCATCAAAGTGAA, and the others remained unchanged, and quantitative analysis wa...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap