Unlock instant, AI-driven research and patent intelligence for your innovation.

Exogenous miRNA regulatory target gene prediction method containing three-dimensional free energy

A target gene prediction, exogenous technology, applied in the direction of instrument, sequence analysis, calculation, etc., to achieve the effect of improving accuracy, accurate feature input vector, and improving traditional sequence matching features

Active Publication Date: 2018-05-29
JILIN UNIV
View PDF9 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But there is no method that can incorporate all known features and combine the three-dimensional free energy to make them tuned as parameters.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Exogenous miRNA regulatory target gene prediction method containing three-dimensional free energy
  • Exogenous miRNA regulatory target gene prediction method containing three-dimensional free energy
  • Exogenous miRNA regulatory target gene prediction method containing three-dimensional free energy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Such as figure 1 Shown, the present invention comprises ARM11 microprocessor 01, upper computer 02;

[0061] In the embodiment of the present invention, generally utilize a general-purpose PC computer as host computer 02, this host computer can be identified by the RNA secondary structure of the microprocessor based on the 32-bit S3C6410 core that Samsung produces The device is connected to work together to complete the recognition of RNA secondary structure;

[0062] Both the input unit 0201 and the display unit 0204 of the upper computer 02 use the input and output devices of the PC computer to realize their functions.

[0063] In the present invention, the intercommunication between the host computer 01 and the ARM9 microprocessor 02 can be realized through the Ethernet interface 0203 of the host computer 01 and the Ethernet interface 0204 of the ARM11 microprocessor 02, and the Ethernet interface adopts DM9000 which is fully integrated and has low cost single Fas...

Embodiment 2

[0072] Such as image 3 Shown is the logical function diagram of the present invention. The steps for users to use the device to predict miRNA target genes are as follows:

[0073] 1) Input the miRNA sequence and target sequence through the input unit 0201 of the host computer, and transmit them to the internal storage unit 0121 through the Ethernet interface 0203, and further read the data into the cache unit 0123;

[0074] 2) The sequence preprocessing unit 0131 reads the miRNA sequence and the target sequence from the buffer unit 0123, and judges the format of the input sequence. If the data does not meet the specification, it immediately sends a high-priority error signal and transmits it through the buffer unit 0123 to The internal storage unit 0121 is then transmitted back to the display unit 0204 of the host computer through the Ethernet interface 0203 to output error information; if the sequence format is judged, a sliding window is constructed based on the length of ...

Embodiment 3

[0091] Input the miRNA sequence of hsa-let-7b through the host computer 02: TGAGGTAGTAGGTTGTGTGGTT, and then input the gene sequence of gi|332384207|gb|JF915190.1| Influenza A virus (A / California / 04 / 2009(H1N1)) PB2.

[0092] After calculation, three predicted targets are obtained:

[0093] No.: 1 score: 1.02 position: 767-783;

[0094] No.: 2 score: 1.0 position: 767-784;

[0095] No.: 3 score: 0.97 position: 767-785.

[0096] The present invention adopts classic double luciferase verification method:

[0097] 1. Select the Marc-145 cell line as the host cell, and select the psi-CHECK2 plasmid as the basis for vector construction.

[0098] 2. Amplify the DNA fragment of the GFP (green fluorescent protein) gene, the DNA fragment of the target gene and the DNA fragment of the YMP gene (yellow fluorescent protein).

[0099] 3. Carrier construction:

[0100] 1. After digestion, connect the GFP gene fragment and the target gene fragment into GFP-target gene.

[0101] 2. Dig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an exogenous miRNA regulatory target gene prediction method containing three-dimensional free energy. In order to improve traditional sequence matching characteristics, statistical characteristics of the three-dimensional energy in a seed area and statistical characteristics of a spatial distribution penalty function at binding sites are newly provided, the characteristicsof the seed area binding sites represent the specific matching information of the binding sites, so that a constructed feature input vector is more accurate and more practical, and therefore the accuracy of miRNA target spot prediction is improved.

Description

technical field [0001] The invention discloses a target gene prediction method and device regulated by exogenous miRNA including three-dimensional free energy, and belongs to the field of bioinformatics miRNA target gene prediction. [0002] The invention relates to a method for predicting miRNA target genes by improving traditional features, introducing three-dimensional free energy features and penalty function features based on position and gap size, and provides a device suitable for the method. Background technique [0003] For a long time, the scientific community has agreed that any nucleic acid and protein in food will be completely digested and absorbed into the body in the digestive system, and then reassembled according to its own needs. However, in 2011, the research group of Professor Zhang Chenyu of Nanjing University published an article in "Cell research" and proposed a major discovery - plant miRNAs can enter human blood and tissues and organs through daily ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G06F19/22G06F19/20
CPCG16B25/00G16B30/00
Inventor 刘元宁王林宇徐瑞张浩赵奇段云娜刘海明
Owner JILIN UNIV