Improved promoter, vector formed by improved promoter and application of improved promoter

A technology of promoters and recombinant vectors, which is applied in the field of genetic engineering, can solve the problems that T vectors cannot be cloned, and achieve the effect of avoiding the defects of false positive clones, false positives and false negatives

Active Publication Date: 2018-06-05
GENEWIZ INC SZ
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Therefore, the technical problem to be solved in the present invention is to overcome that the T vector prepared in the prior art cannot be cloned, or produce a large number of false positive or false negative clones, thereby providing an improved promoter and the carrier and application of its composition

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved promoter, vector formed by improved promoter and application of improved promoter
  • Improved promoter, vector formed by improved promoter and application of improved promoter
  • Improved promoter, vector formed by improved promoter and application of improved promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1: Construction and functional verification of high-copy cloning vectors

[0085] This embodiment provides a method for constructing a high-copy cloning vector, including the following specific steps:

[0086] 1) The lacZα gene of pUC57 (kanamycin resistance) is replaced by the ccdB gene, specifically as follows:

[0087] (1) Whole gene synthesis ccdB gene (synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.), the nucleotide sequence is shown in SEQID NO.11:

[0088] ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA;

[0089] (2) Using the pUC57 plasmid with kanamycin resistance as a template and using SEQ ID NO.29-30 as primers for PCR amplification reaction, the specific sequence is as follows:

[0090...

Embodiment 2

[0155] Embodiment 2 Cloning carrier of the present invention overcomes the experimental verification of false positive clones

[0156] Three pUC57-ccdB-lacI-Mu-4 mutant plasmids (pUC57-ccdB-lacI-Mu-4A, pUC57-ccdB-lacI-Mu-4B, pUC57-ccdB-lacI-Mu-4C) were constructed to simulate pUC57-ccdB- After the lacI-Mu-4 plasmid is digested by EcoRV, 1-2 bases are deleted at both ends of the restriction site and self-ligation occurs. The construction steps are as follows:

[0157] (1) Take the plasmid pUC57-ccdB-lacI-Mu-4 constructed in Example 1 as a template, and use F1-del+R1-del, F2-del+R2-del, F3-del+R3-del as primers respectively Carry out PCR amplification reaction, the nucleotide sequence of described primer F1-del, R1-del, F2-del, R2-del, F3-del, R3-del is shown in SEQ ID No.39-SEQ ID No.44 , the details are as follows:

[0158] SEQ ID NO. 39 (F1-del): ACAACATACGAGATTCAGCATAAAGTGTAAAGCCTGGGGTGC;

[0159] SEQ ID NO. 40 (R1-del): CTTTATGCTGAATCTCGTATGTTGTGTGGAATTGTGAGC;

[0160] ...

Embodiment 3

[0169] Example 3: Construction and functional verification of low-copy T vectors

[0170] This embodiment provides a method for constructing a low-copy T vector, comprising the following steps:

[0171] 1) The lacZα gene of pCK (kanamycin resistance) is replaced by the ccdB gene, as follows:

[0172] (1) Using the pCK plasmid with kanamycin resistance as a template and using SEQ ID NO.45-46 as primers to perform PCR amplification reaction, the specific sequence is as follows:

[0173] SEQ ID NO.45 (forward primer): TTATAGGTGTAAACCTTAAACTGCATAGCTGTTTCCTGTGTGAAATTGTTATCC;

[0174] SEQ ID NO.46 (reverse primer): TTAACCTGATGTTCTGGGGAATATAATTAAGCCAGCCCCGAGTAGCTAGACAGG;

[0175] PCR reaction system is as shown in embodiment 1 table 1, and reaction condition is as shown in embodiment 1 table 2:

[0176] (2) The PCR reaction solution obtained in step (1) is subjected to 1% agarose gel electrophoresis and then gel-cut to recover and purify to obtain a PCR amplification product;

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and relates to an improved promoter, a vector formed by the improved promoter and application of the improved promoter. The improved promoter isused for mutating nucleotide sequences from a -35 area to a -10 area in a promoter region into recognition sites of endonuclease. The improved promoter can be used for solving the problem that the cloning cannot be achieved, which is caused as a transcription or a translation product of an exogenous gene, which is promoted by a strong promoter existing in a vector adopting blue and white screening, possibly has toxicity to a host, can be used for avoiding the defect that the vector loses 1bp to 2bp at an enzyme digestion site to cause the frame shift mutation of a gene to generate false positive cloning, and can be used for eliminating the false negative phenomenon that a plate all has locus ceruleus, which is caused as an extraneous DNA (Deoxyribonucleic Acid) fragment is smaller and moreover a reading frame of the gene is not changed by the insertion of extraneous DNA.

Description

technical field [0001] The present invention belongs to the field of genetic engineering, relates to an improved promoter and the carrier and application thereof, in particular to an improved promoter, a carrier with the improved promoter, and a host cell with the T vector and its application. Background technique [0002] The invention of PCR technology is a major breakthrough in the fields of molecular biology and genetic engineering. After the birth of PCR technology, the technology of cloning PCR products into vectors (usually plasmids) has also been developed. Common and relatively simple cloning methods include TA cloning and blunt-end ligation. The PCR product amplified by Taq enzyme contains dAMP tail, and under the action of T4 ligase, it can be ligated with the carrier (T carrier) containing T-terminus, which is TA clone. High-fidelity DNA polymerases usually contain 3'-5' exonuclease activity, and the PCR products amplified by them are blunt ends. Ligation of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/70C12N15/66C12N1/21C12R1/19
CPCC12N9/2471C12N15/66C12N15/70C12Y302/01023C12N2800/22C12N2800/60C12N2830/001C12N2830/15C12P21/00C12Q2525/143
Inventor薛高旭贾延凯齐甜铭冯爱华谢正立吴昕孙中平廖国娟
OwnerGENEWIZ INC SZ