Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for identifying scylla paramamosain from scylla serrate

A technology of Scylla serrata and Scylla serrata, which is applied in the field of identifying Scylla serrata and Scylla serrata, can solve the problems of resource decline of wild blue crabs and imminent artificial breeding, etc., and achieve the effect of accurate identification

Active Publication Date: 2018-07-06
NINGBO UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The blue crab has the characteristics of large size, fast growth, strong adaptability, delicious meat, and rich nutrition. According to the trawling survey conducted by Chen Pimao and others in various reef areas from 2002 to 2004, the resource density of crabs is 180.985kg·km -2 , but the proportion of economic crabs is only 26.69%, and Scylla serrata, which has a high occurrence rate and high economic value in previous surveys, was not caught, so the artificial breeding of Scyllas is imminent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying scylla paramamosain from scylla serrate
  • Method for identifying scylla paramamosain from scylla serrate
  • Method for identifying scylla paramamosain from scylla serrate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Screening of Molecular Markers for Distinguishing Scylla pseudophylla and Scylla serrata

[0026] Obtain the mtDNA sequences of Scylla pseudocavena and Scylla serrata in the NCBI database, and use AlignX (a component of Vector NTI Suite 7.1) software to perform sequence alignment to find out the difference base region in Scylla; finally screen the obtained consensus Sequence, in the interval 13274-13362 of the consensus sequence, based on the consensus sequence, primers were designed, PCR was amplified and verified by sequencing, and the counted SNP position was 13334, a total of 1 SNP site. The sequence of the corresponding nucleotide fragment in Scylla paramamosain comprising the above SNP site is SEQ ID NO: 1:

[0027] AATTAAAAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCTATTTAACA-TTTTTGTCAGTGAGCAGGCTAGACTATA;

[0028] The sequence of the corresponding nucleotide fragment in Scylla serrata (Scylla_serrata) is SEQ ID NO: 2:

[0029] AATTAAAAAACTAATGATTATGCT...

Embodiment 2

[0037]Example 2 Utilize SNP sites to identify blue crabs

[0038] The mud crabs used, mud crabs serrata, and mud crabs were collected from healthy individuals in Lulin Market, Ningbo City, China, and Sanmen County, China, respectively. The morphological identification was carried out according to the morphological characteristics of mud crabs studied by Lin Qi et al. Take 30 individuals of each variety, take swimming foot muscle tissue respectively, use phenol-chloroform method to extract genomic DNA, dilute the extracted DNA to 100ng / microliter, and use 1.5% agarose gel electrophoresis to detect its integrity, save Store at -20°C for later use.

[0039] PCR reactions were performed in a Roche Light Cycle 480 instrument. The reaction system is 20 microliters, including 10 microliters LC-HRM master Mix 10 microliters, forward and reverse primers 1.5 microliters, template DNA 1.2 microliters, grade H 2 O 3 µl. The reaction program was pre-denaturation at 95°C for 10 min, dena...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for identifying scylla paramamosain from scylla serrate. The method comprises the following steps: extracting nucleic acid samples from to-be-detected scylla samples, then amplifying the nucleic acid samples by a PCR primer pair for genotyping, wherein the sequence of a corresponding nucleotide fragment in the scylla paramamosain is shown as a SEQ ID NO: 1 and the sequence of a corresponding nucleotide fragment in the scylla serrate is shown as a SEQ ID NO: 2. With the method provided by the invention, the scylla paramamosain can be effectively identified from the scylla serrate; through a high-resolution melting curve HRM, the to-be-detected scylla samples are typed, so that scylla germplasms are quickly and accurately identified and a technical support isprovided for scylla breeding cultivation.

Description

technical field [0001] The invention belongs to the technical field of genetic breeding assisted by molecular markers, and in particular relates to a method for identifying mud crabs and mud crabs. Background technique [0002] The genus Scylla belongs to the class Crustacea, order Decapode, suborder Brachyura, and family Portunidae. Widely distributed in the coastal waters of the Indian-West Pacific Ocean, including mangrove areas and estuary bays in Southeast Asia, Australia, Japan, India, South Africa, etc. In my country, it is mainly distributed in the coastal waters of Zhejiang, Fujian, Taiwan, Guangdong, Guangxi and Hainan . The blue crab has the characteristics of large size, fast growth, strong adaptability, delicious meat, and rich nutrition. According to the trawling survey conducted by Chen Pimao and others in various reef areas from 2002 to 2004, the resource density of crabs is 180.985kg·km -2 , but the proportion of economic crabs is only 26.69%, and Scylla s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2600/156C12Q2527/107
Inventor 陈夏月李荣华王春琳母昌考宋微微叶央芳刘磊史策
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com