Chimeric antigen receptor modified lymphocyte capable of expressing CXCR4, and preparation method and applications thereof

A chimeric antigen receptor and lymphocyte technology, applied in the field of cells, can solve the problems of limited chemotactic activity, decreased expression of chemokine receptors, and lack of tumor-specific antigens.

Active Publication Date: 2018-07-13
SICHUAN UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003]Although chimeric antigen receptor-modified lymphocytes have attractive prospects in tumor immunotherapy, there are still several problems: 1. Lack of tumor-specific antigens
We found that after T cells were genetically modified by lentivirus, the expression of chemokine receptor CXCR4 was significantly decreased and the chemotactic activity was limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor modified lymphocyte capable of expressing CXCR4, and preparation method and applications thereof
  • Chimeric antigen receptor modified lymphocyte capable of expressing CXCR4, and preparation method and applications thereof
  • Chimeric antigen receptor modified lymphocyte capable of expressing CXCR4, and preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0123] Example 1 Obtaining CAR, CAR / CXCR4 full-length genes, and completing the construction of recombinant plasmid vectors

[0124] 1. Acquisition of full-length scFv-CAR and scFv-CAR / CXCR4 gene

[0125] The scFv-CAR and scFv-CAR-P2A-CXCR4 gene fragments were obtained by the whole gene synthesis method.

[0126] At the same time, the following primers were designed to amplify the scFv-CAR fragment:

[0127] 5' Primer: 5'AGGTTTAAACTACGGATGGTGCTGCTGGTGACCTCCC3' SEQ ID NO: 25

[0128] 3' primer: 5' ATGACTAGTCCCGGGTTAGCGAGGGGGCAGGGCCTGC3' SEQ ID NO: 26

[0129] The reaction conditions are as follows:

[0130] PCR reaction: Denaturation at 94°C for 30 seconds; annealing at 60°C for 30 seconds; extension at 68°C for 1 minute. React 25 cycles. This was then extended for an additional 10 minutes at 72°C.

[0131] Design the following primers to amplify the scFv-CAR / CXCR4 fragment:

[0132] 5' Primer: 5'AGGTTTAAACTACGGATGGTGCTGCTGGTGACCTCCC3' SEQ ID NO: 27

[0133] 3' primer: ...

Embodiment 2

[0155] Example 2 Lentiviral Packaging and Production of CAR-T Cells

[0156] 1. Lentiviral packaging

[0157] 293T cells were cultured with DMEM+10% fetal bovine serum (FBS), and used for virus packaging when they grew to a density of 70-90%. The steps were as follows: 2 hours before transfection, replace with fresh preheated DMEM medium (containing 10% FBS) , Prepare the transfection system in a 15ml centrifuge tube: the experimental conditions are shown in Tables 2 and 3.

[0158] Table 2 plasmid system

[0159]

[0160] Table 3 transfection system:

[0161]

[0162] After mixing, evenly add the transfection solution to the plate, at 37°C, 5% CO 2 Continue to grow in the incubator. After 12h, replace with DMEM+2%FBS medium. Collect the virus supernatant at 48h and 72h respectively, filter the virus liquid through a 0.45μm filter membrane, ultracentrifuge at 160,000g at 4°C for 90min, resuspend in PBS, aliquot and store at -80°C.

[0163] 2. T cell infection

[0...

Embodiment 3

[0165] Example 3 Detection of CXCR4 expression in T cells

[0166] The lentivirus constructed in Example 1 was used to infect or uninfect T cells and peripheral blood mononuclear cells, change the medium after 24h, and use X-VIVO 15 (04-418Q, LONZA company) complete medium+10% human AB serum ( H4522, sigma company) continued to culture for 5 days, and at the same time, 100 U / ml of recombinant human interleukin 2 (IL-2) cytokine (C013, novaprotein company) was added. Then the cells were collected, washed twice with PBS, stained with APC-labeled anti-human CXCR4 antibody (product number 306510, biolegend company), and the expression of CXCR4 in the cell membrane was detected by flow cytometry. The expression of CXCR4 in blood monocytes decreased significantly, and its fluorescence intensity (log value) decreased from 238 to 174 ( Figure 4 ), the expression of CXCR4 decreased more significantly after T cells were infected with lentivirus, and its fluorescence intensity (log val...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
fluorescenceaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of cell therapy, and especially relates to a chimeric antigen receptor modified lymphocyte capable of expressing CXCR4, and relates to genetic engineering means. According to the genetic engineering means, non-specific lymphocytes are modified into lymphocytes capable of identifying tumor surface related antigens and expressing chemotactic factor acceptor CXCR4,so that enrichment at specific parts is realized, and targeting killing on specific cells is realized. The invention also discloses a preparation method of the specific lymphocytes, and applications thereof in malignant tumor treatment.

Description

technical field [0001] The present invention relates to the field of cells, in particular to genetically engineered non-specific lymphocytes that can recognize tumor surface-associated antigens and express chemokine receptor CXCR4, thereby enriching and killing cells at specific sites. Preparation method of sex lymphocytes and its use in the treatment of malignant tumors. Background technique [0002] Immunotherapy is considered to be the most promising tumor treatment method. Among them, immune checkpoint inhibitors (such as CTLA-4, PD-1, etc.) have shown significantly better effects than existing therapies in various tumor clinical trials, and have been approved for malignant tumors such as non-small cell lung cancer and bladder cancer. Tumor treatment. Unlike CTLA-4 and PD-1 antibodies, which exert anti-tumor effects by reactivating the body's immune response, chimeric antigen receptor-modified immune cell therapy does not depend on the body's immune status. Through gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/62A61K35/17A61P35/00
CPCC12N5/0636C07K14/7051C07K14/7158C12N2510/00C07K2319/02C07K2319/03A61K39/464421A61K39/4611A61K39/4631A61P35/00C07K19/00C12N5/10C12N15/62C12N15/86
Inventor王永生魏于全郭福春王玮
OwnerSICHUAN UNIV