Microorganism and uses thereof
A gene editing and protein technology, applied in the field of bioengineering, can solve problems such as not widely used, Cas9 protein cannot be expressed correctly, sgRNA is not transcribed correctly, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1. Construction of clones of purified Cas9 proteins
[0026] Using primer 1: ATATCATATGCCCAAGAAGAAGCGCAAGGTC and primer 2: AATTGGATCCTTAGCACTTCTTCTTCTTGGCCTGACCAGCCTTCTTGGTAGCAGCAGGACGCTTGTACAGCTCGTCCATGCCGA to amplify Cas9 protein and add nuclear localization sequence (NLS) and cysteine at its end. Among them, the NLS sequence facilitates the entry of the Cas9 protein into the nucleus, and the cysteine facilitates the engagement of the Cas9 protein with the cell-penetrating peptide (CPP). The fragment of the Cas9 protein amplified with the above primers was digested by NdeI and BamHI and cloned on the pET28 plasmid after digestion with the same enzyme, so that the Cas9 protein expressed in connection with the active cutting protein of NLS and Cas9 could be obtained. The Cas9 protein nucleotides contained therein are as follows:
[0027]ATGCCCAAGAAGAAGCGCAAGGTCGGTATCCACGGCGTTCCTGCCGCTGACAAGAAGTACTCCATCGGTCTCGACATCGGCACCAACTCCGTCGGTTGGGCTGTTATCACCGACGAGTACAA...
Embodiment 2
[0028] Embodiment 2: purify Cas9 protein
[0029] Transform pET28-Cas9 into BL21, draw about 50-60 single clones from each plate and inoculate them into 10 mL of LB medium with kanamycin resistance, and culture in a shaker at 37°C for 2-3 hours. Inoculate 500 mL of LB medium with kanamycin resistance at 1%, put it into a shaker at 37°C at 220rpm and cultivate until the OD value is between 0.6-0.8 (about 2h). After adding IPTG with a final concentration of 0.5mM, the temperature was changed to 30°C, and the shaker was incubated at 220rpm for about 18h.
[0030]Put the cultured bacteria liquid into the collection bottle, centrifuge at 3500rpm for 15min, remove the supernatant, repeat several times until the bacteria are collected, then resuspend and wash the bacteria once with sterile water, centrifuge at 3500rpm for 15min, remove the supernatant After the cells were homogenized, the supernatant was collected and filtered with a 0.45 μm filter membrane. The standard HIS-tagged...
Embodiment 3
[0032] Example 3 Cas9 is linked with cell penetrating peptide to form CPP-Cas9 protein
[0033] Mix purified 1mg of Cas9 protein with 50mg of cell penetrating peptide
[0034] (4-maleimidobutyryl-GGGRRRRRRRRRLLLL, medium peptide) mixed at room temperature, inverted and mixed for 2 hours, centrifuged and concentrated with a 50kDa protein centrifugal concentration column (millipore) to remove unbound polypeptides, collected linked CPP-Cas9 protein, and measured protein concentration .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


