Construction method of gene knockout CHO cell line and application of gene knockout CHO cell line in expression of therapeutic recombinant proteins

A recombinant protein and gene knockout technology, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, anti-animal/human immunoglobulin, and other methods of inserting foreign genetic materials, etc. Reduced cell growth rate, blocked cell line selection process, slowed down cell mitosis, etc., to achieve the effect of improving expression yield

Active Publication Date: 2018-09-07
ANHUI UNIVERSITY
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Changing the anti-apoptosis or pro-apoptosis genes alone still has disadvantages, such as the growth rate of CHO cells is slowed down, and the selection process of cell lines is hindered; cell mitosis is slowed down during the process of antibody production, and the desired cell density cannot be achieved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of gene knockout CHO cell line and application of gene knockout CHO cell line in expression of therapeutic recombinant proteins
  • Construction method of gene knockout CHO cell line and application of gene knockout CHO cell line in expression of therapeutic recombinant proteins
  • Construction method of gene knockout CHO cell line and application of gene knockout CHO cell line in expression of therapeutic recombinant proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1, the preparation of CHO-K1-sgRNA3 cell

[0028] 1. sgRNA design

[0029] The open reading frame of the CYLD gene in CHO cells contains 16 exons. According to the CRISPR-Cas9 technical requirements and sequence homology comparison analysis, four sgRNAs (sgRNA1-4) were screened and designed, and sgRNA1 and sgRNA4 simultaneously targeted Exon 1, sgRNA2 and sgRNA3 target exons 6 and 7, respectively. The target sequences of the four sgRNAs are shown in Table 1 below, and the positions on the CYLD exons are shown in the results figure 1 shown.

[0030] Table 1 Four sgRNA target sequences

[0031] name

Sequence (5'-3')

sgRNA1

CCAGGAGTTGTACGCTTCAG

sgRNA2

TATGGGGTTATCCGTTGGAT

sgRNA3

GCTGTACGGACGGAACTTTC

sgRNA4

CCTCTGAAGCGTACAACTCC

[0032] 2. Construction of recombinant plasmids

[0033] Further, the DNA sequences in Table 1 and their complementary pairs were synthesized according to the requirements...

Embodiment 2

[0048] Embodiment 2, the preparation of CHO-IgG-sgRNA3 cell

[0049] A CHO-K1 suspension cell stably expressing anti-EGFR humanized antibody L4H3 was used to verify the effect of inhibiting CYLD on antibody expression. The cell construction process for stably expressing the anti-EGFR humanized antibody is as follows:

[0050] 1. Recombine the double-stranded DNA molecule shown in sequence 7 of the sequence listing between the HindIII and NotI restriction sites of the pcDNA-3.3 vector to obtain the recombinant plasmid pcDNA3.3-L4.

[0051] 2. The complete sequence 8 of the sequence listing was recombinantly cloned between the HindIII and NotI restriction sites of the pOptiVEC vector to obtain the recombinant plasmid pOptiVEC-H3.

[0052] 3. The recombinant plasmid pcDNA3.3-L4 and the recombinant plasmid pOptiVEC-H3 were co-transfected into CHO-K1 cells, and the recombinant cells stably expressing the heavy and light chains of the antibody were screened and domesticated into su...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a gene knockout CHO cell line and application of the gene knockout CHO cell line in the expression of therapeutic recombinant proteins. The construction method comprises the following steps: imputing a knockout vector in a CHO cell, and then performing the screening to obtain the knockout plasmid mediated CYLD expression-deficient cell line. The nucleotide sequence SEQ ID NO:1 in the knockout cell can be replaced with SEQ ID NO: 2, NO: 3, NO: 4, NO: 5 or NO: 6; and the transfected cell can be the CHO-K1 cell or the CHO cell for stably expressingan antibody. The construction method has important application value for increasing the expression yield of the therapeutic recombinant proteins.

Description

technical field [0001] The invention mainly relates to the construction of a CHO modified cell line and its application in the process of expressing therapeutic recombinant proteins. Background technique [0002] In recent years, therapeutic antibodies have achieved remarkable curative effects in the prevention and treatment of clinical malignant tumors, autoimmune diseases, and rapid infectious diseases. At the same time, it has also promoted the overall development of the antibody industry. The total output value of the global antibody industry has been increasing year by year. According to statistics, the global sales of monoclonal antibodies in 2016 were nearly 70 billion US dollars, and it is increasing at a rate of about 10%. However, my country's antibody industry is still dominated by imitation and lacks effective innovation in antibody varieties. At the same time, the overall production capacity is seriously insufficient. The literature reports that the average out...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N9/22C07K16/28
CPCC07K16/2863C12N9/22C12N15/907
Inventor张部昌韩倩倩徐昌志鲁亚芳周琴吴鹏飞张兰兰邵国建喻阳
OwnerANHUI UNIVERSITY