Supercharge Your Innovation With Domain-Expert AI Agents!

Sensor molecules for screening ligands of insect sex pheromone receptors and screening methods

A pheromone and sensor technology, applied in chemical instruments and methods, receptors/cell surface antigens/cell surface determinants, biochemical equipment and methods, etc., can solve the complex method of screening insect sex pheromone receptor ligands To achieve accurate and effective drug screening and rapid screening

Active Publication Date: 2021-11-23
SHANDONG UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In view of the above-mentioned shortcoming of prior art, the object of the present invention is to provide a kind of sensor molecule that screens the ligand of insect sex pheromone receptor and screening method, fill up the gap in the prior art, solve the problem of screening insect sex in the prior art. Ligands for pheromone receptors are too complex a problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sensor molecules for screening ligands of insect sex pheromone receptors and screening methods
  • Sensor molecules for screening ligands of insect sex pheromone receptors and screening methods
  • Sensor molecules for screening ligands of insect sex pheromone receptors and screening methods

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] 1. Construction of expression vector

[0046] Using pRluc as a template, PCR amplification was performed with the following primers to obtain the Rluc fragment:

[0047] F (SEQ ID: 1): ATGACTTCGAAAGTTTTATGATCCAGAACAAAGGAAACGG,

[0048] R (SEQ ID: 2): TTGTTCATTTTTGAGAACTCGCTCAACGAACGATTTG

[0049] Using pApisOR5 as a template, PCR amplification was performed with the following primers to obtain a nucleic acid fragment with the amino terminal of ApisOR5 as the junction point:

[0050] F (SEQ ID: 3): CTCAAAAATGAACAAGCCACCATGCAGCGCATCGAC,

[0051] R (SEQ ID: 4): AAACTTTCGAAGTCATGGTACCAAGCTTAAGTTTAAACGCTAGCC

[0052] Using pBmorOR3 as a template, PCR amplification was performed with the following primers to obtain a nucleic acid fragment with the amino terminal of BmorOR3 as the junction point:

[0053] F (SEQ ID: 5): CAAAAATGAACAAGCCACCATGATCTTCGTGGACG.,

[0054] R (SEQ ID: 6): AAACTTTCGAAGTCATGGTACCAAGCTTAAGTTTAAACGCTAGCC

[0055] The above fragments were subjected t...

Embodiment 2

[0068] 1. Preliminary synthesis of ligands

[0069] The compound selected from the components of the sex attractant that has been put into use is searched for the insect olfactory receptor gene sequence corresponding to the compound, that is, the pheromone, and is synthetically modified as a target for screening similar compounds.

[0070] 2. Construction of expression vector

[0071] After simulating the receptor sequence with software, a schematic diagram of its structure is obtained. The odorant receptor ApisOR5 of the pea aphid is a seven-transmembrane protein whose amino terminal is located in the cell. It is connected to the bioluminescence resonance energy transfer donor protein Rluc at the amino terminal, and is inserted into the LOOP ring in the receptor cell membrane, that is, the transmembrane region Bioluminescence resonance energy transfer receptor protein enhanced yellow fluorescent protein eYFP, the specific insertion position is after the 89th amino acid argin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a sensor molecule and a screening method for screening ligands of insect sex pheromone receptors. The molecule comprises: a pheromone receptor, and the amino terminal of the pheromone receptor is connected with a bioluminescent resonance energy transfer donor protein A bioluminescent resonance energy transfer acceptor protein is inserted inside the pheromone acceptor, and the interaction between the donor protein and the acceptor protein sends out a BRET signal. The method provided by the invention can conveniently and rapidly screen insect sex pheromones, and provides a new way for preparing sex attractants, controlling pests and protecting the environment.

Description

technical field [0001] The invention relates to a sensor molecule for screening ligands of insect sex pheromone receptors and a screening method. Background technique [0002] Pheromone, also known as pheromone, refers to a compound used for information exchange between individuals of the same species. It was proposed by Karlson and Butenandt in the early years, meaning "carrying" and "stimulating". Using chemical substances to exchange information is an ancient and effective communication method for animals in nature, which can be found in various animals, including mammals and arthropods. [0003] Insect pheromones are the chemical language used by insects for information exchange, conveying various information such as gathering, foraging, mating, vigilance, and social rank, creating a reasonable "social order" among insects of the same species. Among them, insect sex pheromone is a compound that regulates the attraction and mating behavior of insects. It is secreted by f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N9/02C12Q1/02
CPCC07K14/705C07K2319/60C07K2319/61C12N2503/00G01N33/5041G01N2333/705
Inventor 孙金鹏陈新杜继翔林靖宇于晓
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com