A kind of s-adenosyl homocysteine ​​hydrolase mutant and its application and preparation method, nucleic acid, expression vector and host cell

A cysteine, adenosine homotype technology, applied in the field of cells, can solve the problems of reduced catalytic activity, weakened catalytic activity, insufficient heat resistance, etc., and achieves the effects of stable recombinant plasmid, improved activity and high expression.

Active Publication Date: 2021-09-03
浙江微景生物科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the heat resistance is not good enough
[0006] Yu Kaixi (homocysteine ​​detection method using small molecule capture technology, application number: CN03145972.2) used mutated SAHH as a kit component to participate in the detection of homocysteine. Acid affinity increased, but catalytic activity decreased by 10%-50%
[0007] Yuan Chongsheng (homocysteine ​​detection method, patent number: US7192729 B2) used mutated SAHH as a kit component to participate in the detection of homocysteine. The mutated SAHH improved the homocysteine ​​and S-adenosine homotype Affinity for cysteine ​​or adenosine, but reduced catalytic activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of s-adenosyl homocysteine ​​hydrolase mutant and its application and preparation method, nucleic acid, expression vector and host cell
  • A kind of s-adenosyl homocysteine ​​hydrolase mutant and its application and preparation method, nucleic acid, expression vector and host cell
  • A kind of s-adenosyl homocysteine ​​hydrolase mutant and its application and preparation method, nucleic acid, expression vector and host cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1 Error-prone PCR (error-prone PCR) method to construct SAHH mutation library

[0058] Using the GeneMorph II random mutagenesis kit, the optimized SAHH (see SEQ ID NO.2) nucleotide sequence was used as a template to amplify the SAHH gene and randomly introduce mutations.

[0059] Amplification primer

[0060] F: 5'-AC ACATGT CTGACAAGTTGCCATACAAG (PscI endonuclease is underlined)

[0061] R: 5'-CCG CTCGAG TCAGTATCTGTAGTGGTCTG (XhoI endonuclease is underlined)

[0062] Reaction conditions: pre-denaturation at 94°C for 10 min, denaturation at 94°C for 30 s, annealing at 60°C for 60 s and extension at 72°C for 2 min, a total of 25 cycles, 0.8% agarose electrophoresis, and the kit to recover the target gene fragment. According to the method described in the product manual of NEB Company, after double digestion with PscI and XhoI, perform ligation reaction with the pET-28a(+) vector (kana resistance) digested with NcoI (PscI and NcoI are homologous enzymes) and ...

Embodiment 2

[0063] Example 2 Screening of SAHH mutant library

[0064] After the mutant library clones in Example 1 were collected, the plasmids were extracted, transformed into E. coli expression strain BL21 (DE3), spread on LB plates containing kana, and cultured for 12 hours. Pick a single clone in a 96-well plate, each well contains 150 μL of TB medium (containing 50 μg / mL kanamycin, 1 mM IPTG), 37 ° C, 245 rpm, shaking culture for 36 h. The 96-well plate replicator replicated each single clone on an LB solid medium plate, cultured at 37°C for 12 hours, and stored in a refrigerator at 4°C. Gently suck out the cell cultures in each well of the 96-well plate with a row gun, and distribute them in the 96-well plates of plate A and plate B according to the corresponding positions, and the culture in each well of each 96-well plate is 70 μL. Centrifuge at 4000rpm at 4°C for 10min, discard the supernatant, and resuspend the bacterial cells in each well with 30μL, 50mM, pH7.6 sodium phospha...

Embodiment 3

[0067] Embodiment 3 Stability detection

[0068] The mutants in plate B were screened out to 5 mutants with improved enzyme activity and stability, and the mutant monoclonals were sent to a sequencing company for sequencing. The amino acid sequence is shown in SEQ ID NO.3-SEQ ID NO in Table 3. 7.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

In the present invention, an S-adenosyl homocysteine ​​hydrolase mutant is screened out by error-prone PCR and shuffling methods, which comprises N27A, M38H, L45I, N27A, M38H, L45I, Mutations at any two or more amino acid sites of E65D, T84S, Y110F, N126D, P176A, K204D, T276S, V316A, A368V. The mutant has doubled its activity, improved stability, and better heat resistance. The invention also discloses nucleic acid encoding the S-adenosyl homocysteine ​​hydrolase mutant, an expression vector including the nucleic acid, and a host cell including the expression vector.

Description

technical field [0001] The present invention relates to an enzyme and its application and preparation method, a nucleic acid encoding the enzyme, an expression vector comprising the nucleic acid, and a host cell comprising the expression vector, which involves a hydrolysis of S-adenosyl homocysteine Enzyme mutant and its application and preparation method, the nucleic acid encoding the S-adenosyl homocysteine ​​hydrolase mutant, the expression vector including the nucleic acid, and the host cell including the expression vector. Background technique [0002] Homocysteine ​​(Hcy) is a sulfhydryl-containing amino acid and is a metabolic intermediate in the methionine cycle in the body. A pathological increase in total Hcy concentration in the blood leads to hyperhomocysteinemia. Studies in recent years have confirmed that hyperhomocysteinemia is closely related to the occurrence of various cardiovascular diseases such as atherosclerosis, hypertension, and myocardial infarction...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/14C12N15/55C12N15/70C12N1/21C12R1/19
CPCC12N9/14C12N15/70C12Y303/01001
Inventor王晓霞彭毅
Owner浙江微景生物科技有限公司