Supercharge Your Innovation With Domain-Expert AI Agents!

Preparation method of zebrafish notch2 gene mutant

A t7-notch2-sfd, zebrafish technology, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, genetic engineering, etc.

Active Publication Date: 2018-10-26
SHANGHAI OCEAN UNIV
View PDF34 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no specific treatment, but cholestyramine or traditional Chinese medicine can be given to treat cholestasis and supplement fat-soluble cellulose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of zebrafish notch2 gene mutant
  • Preparation method of zebrafish notch2 gene mutant
  • Preparation method of zebrafish notch2 gene mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0044] 1 Materials and equipment

[0045] 1.1 Experimental fish

[0046] The zebrafish used in this experiment were all AB strains, purchased from the Zebrafish Platform of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0047] 1.2 Plasmid

[0048] The pUC19-gRNA scaffold plasmid is derived from literature: Chang N, Sun C, Gao L, Zhu D, Xu X, ZhuX, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9 nuclease in zebrafishembryos, Cell Res, 2013, 23( 4): 465-472.

[0049] The pUC19-gRNA scaffold plasmid template sequence used in gRNA product synthesis is:

[0050] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 1).

[0051] 1.3 Main reagents

[0052] DNA Clean&Contentrator-5 (ZYMO RESEARCH, D4004), common DNA purification kit (TIANGEN, DP204-03), T7 in vitro Transcription Kit (Ambion, AM1314), ethanol (absolute ethanol) (Sinopharm Chemical Reagent C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a zebrafish notch2 gene mutant. The preparation method includes: determining positions of knock-out target spots of the notch2 gene; utilizing pUC19-gRNA scaffold plasmid as a template, and performing PCR (polymerase chain reaction) amplification with primers T7-notch2-sfd and tracr rev; subjecting a PCR product to purification and in-vitro transcription to obtain gRNA (guide ribose nucleic acid); introducing the gRNA and Cas9 protein into a cell-stage embryo of zebrafish through micro-injection, and screening to obtain the notch2 gene mutant stable in inheritance. The preparation method has the advantages that by the aid of the CRISPR / Cas9 (clustered regularly interspersed short palindromic repeats, CRISPR / CRISPR-associated genes, cas gene)technology, and by means of selecting a specific section of targeting domain, the notch2 gene in the zebrafish is knocked out, other genes are protected from being 'injured accidentally', the zebrafish without the Notch2 gene is formed, experimental materials are provided for in-depth study on follow-up gene functions, and great significance is achieved on study of Notch signal channels.

Description

technical field [0001] The invention relates to a zebrafish mutant, in particular to a method for preparing a zebrafish notch2 gene mutant. Background technique [0002] The CRISPR / Cas system was first discovered in the adaptive immune system of bacteria, and its main function is to fight against invading viruses and foreign DNA. In 1987, researchers at Osaka University discovered clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-related genes (CRISPR- associated genes, Cas gene), it is generally believed that 40% of bacterial genomes have such a structure. CRISPR technology is the latest third-generation genome editing tool, which can complete RNA-guided DNA recognition and editing. CRISPR / Cas9 gene editing technology originates from an acquired immune system of microorganisms to defend against the invasion of phage DNA or foreign plasmids. The defense mechanism of the CRISPR / Cas system can be divided into three stages. In the first stage, ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N9/22A01K67/027
CPCA01K67/0275A01K2217/075A01K2227/40A01K2267/0306C12N9/22C12N15/902
Inventor 张庆华岳倩文徐行季策李伟明
Owner SHANGHAI OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More