F-box protein regulating leaf inclination and its application

An F-BOX, leaf inclination technology, applied in the fields of botany and genetic engineering

Active Publication Date: 2021-09-24
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although there are many studies on the regulation of hormones on rice leaf inclination angle, there is no relevant report on whether OsmiRNA or its target genes in rice can regulate leaf inclination angle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • F-box protein regulating leaf inclination and its application
  • F-box protein regulating leaf inclination and its application
  • F-box protein regulating leaf inclination and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0064] As an embodiment of the present invention, the gene encoding the F-BOX protein is cloned into an appropriate vector by conventional methods, and the recombinant vector with the foreign gene is introduced into the plant cells that can express the F-BOX protein In, the plant cells are made to express the F-BOX protein. Plants overexpressing the F-BOX protein can be obtained by regenerating said plant cells into plants. Preferably, the gene encoding the F-BOX protein is transferred into plants by using the Agrobacterium transformation method.

[0065] The methods may be performed by any suitable conventional means including reagents, temperature, pressure conditions and the like. Other methods of increasing F-BOX expression are known in the art. For example, F-BOX expression can be enhanced by driving with a strong promoter. Or enhance the expression of the F-BOX gene through an enhancer. Strong promoters suitable for the method of the present invention include, but ar...

Embodiment 1

[0077] Example 1. Isolation of F-BOX gene and analysis of excess material phenotype

[0078] In the research on the regulation of rice leaf inclination, the inventors found that the F-BOX gene can regulate the rice leaf inclination.

[0079] The rice material with F-BOX overexpression was obtained by constructing the F-BOX overexpression vector F-BOX-over and transferring it into the rice material.

[0080] The vector construction method is as follows: by using the vector pCAMBIA1301. Using the ZH11 rice genome as a template, the F-BOX cDNA gene was amplified by primers P1 and P2, both of which contained KpnI restriction sites.

[0081] P1: C GGGGTACCATGGGGGAGGTGGCGGCGCTGC (SEQ ID NO: 4);

[0082] P2: CGGGGTACCTCAGGCCAAGGCAGAGGGGCAT (SEQ ID NO: 5);

[0083] KpnI was used for enzyme digestion and dephosphorylation treatment, and the product was subjected to agarose gel electrophoresis and gel cutting to recover, and then ligated into the pCAMBIA1301 vector after the same enz...

Embodiment 2

[0091] Example 2, Construction and Phenotypic Analysis of F-BOX Gene Knockout Materials

[0092] The inventors further edited the F-BOX gene through the Crispr-cas9 technology, designed a pair of primers F-BOX-gRNA-L and F-BOX-gRNA-R through the Crisprdesigner software, and constructed the F-BOX-Crispr-cas9 vector Knockout of the F-BOX gene was achieved.

[0093] F-BOX-gRNA-L:GGCACACTCAAGGAAATTCCGCGC (SEQ ID NO:8),

[0094] F-BOX-gRNA-R:AAACGCGCGGAATTTCCTTGAGTG (SEQ ID NO:9);

[0095] The vector construction of the gene knockout material is completed in two steps. Two vectors, the intermediate vector pOs-sgRNA and the final vector Ph-UBI-cas9-7 (both obtained from Peking University, see Cell Research (2013) 23:1233-1236 ), were used for vector construction. First, the primers F-BOX-gRNA-L and F-BOX-gRNA-R were diluted to 10Um, 10ul each was dissolved in 0.5XTE solution, and the 100ul system was annealed at 98°C for 5 minutes before use. The intermediate vector pOs-sgRNA wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to F-BOX protein for regulating leaf inclination and application thereof. The present invention discovers for the first time that the F-BOX protein can regulate the leaf inclination angle of gramineous plants. By knocking out or down-regulating the F-BOX gene, the leaf inclination angle can be reduced, the plant type can be optimized, and then reasonable dense planting can be realized, and the yield per unit area can be increased. The F‑BOX gene can be applied to the molecular breeding of erect plant type to select high-yield varieties.

Description

technical field [0001] The invention belongs to the fields of botany and genetic engineering, and more specifically, the invention relates to a F-BOX protein for regulating leaf inclination and application thereof. Background technique [0002] Grasses (crops), especially rice, are important food crops. The plant type of rice and other crops is one of the core factors determining its yield. The formation of rice plant architecture mainly depends on factors such as plant height, leaf inclination angle and tiller angle. In rice breeding, the improvement of plant architecture has played an important role in increasing rice yield, and has always been an important indicator of variety breeding. [0003] Some mutants, such as LC1, SLR1, and MOC1, have been found to regulate rice plant height, tillering, and leaf inclination. [0004] Current studies have found that the regulation of hormone signals plays an important role in the leaf inclination of plants, such as auxin and bra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82G01N33/68
CPCC07K14/415C12N15/8213C12N15/8241C12N2810/10C12Q1/6895C12Q2600/13G01N33/68G01N2333/415
Inventor薛红卫渠莉
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI