Cyclic RNA circBCBM1 and non-diagnostic fluorescent quantitative detection method

A fluorescent quantitative detection, circular technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, microbial measurement / inspection, etc., to achieve the effect of strong stability and wide application space

Active Publication Date: 2018-11-13
LIAOCHENG PEOPLES HOSPITAL
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no reports of circRNAs related to brain metastasis of breast cancer, and more in-depth research is needed in this field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cyclic RNA circBCBM1 and non-diagnostic fluorescent quantitative detection method
  • Cyclic RNA circBCBM1 and non-diagnostic fluorescent quantitative detection method
  • Cyclic RNA circBCBM1 and non-diagnostic fluorescent quantitative detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Circular properties of circular RNA circBCBM1:

[0057] ①Primer design and synthesis: design reverse specific primers for circBCBM1 spanning the splice site, the upstream primer is ctgggccact gatgactcct, the downstream primer is tcctggacac ggtagctcca; the linear transcript primer corresponding to circBCBM1 is designed, the upstream primer is tggagctacc gtgtccagga tg, and the downstream primer is gcggctcgatgaagctgtgg; design primers for internal reference gene GAPDH, the upstream primer is tgagaacggg aagcttgtca, and the downstream primer is atcgccccac ttgattttgg;

[0058] ② DNA and RNA extraction and reverse transcription: culture 231-BR cells, extract the whole genomic DNA (gDNA) of the cells, use TRIzol to extract the total RNA of the cells, and reverse transcribe the total RNA into cDNA;

[0059] Wherein the extraction of RNA can be carried out according to the following steps:

[0060] ⑴Add TRIzol to the cell culture plate to lyse the cells, every 10cm 2 Add 1ml to...

Embodiment 2

[0076] Stability of circular RNA circBCBM1:

[0077] ① RNA extraction, processing and reverse transcription: 231-BR cells were cultured, and total RNA was extracted using TRIzol. Add 3U RNase R to 2 μg RNA in the RNase R treatment group, add an equal volume of DEPC water to the control group, and treat at 37°C for 30 minutes; purify the RNA and perform reverse transcription;

[0078] Wherein the extraction of RNA and the process of reverse transcription are the same as in Example 1;

[0079] ②Real-time fluorescent quantitative PCR amplification: the reaction was carried out on Applied Biosystems 7500Real-Time PCR instrument;

[0080] First, prepare the PCR reaction solution according to the following components (the reaction solution is prepared on ice)

[0081] Reagent

Usage amount

Final concentration

TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×)

10μl

PCR Forward Primer (10μM)

0.8μl

0.4μM

PCR Reverse Primer (10μM) ...

Embodiment 3

[0086] Subcellular localization of circular RNA circBCBM1:

[0087] The subcellular localization of circular RNA circBCBM1 was detected by real-time fluorescent quantitative PCR. The cytoplasm and nucleus were separated using the NE-PER kit, and the total RNA in the cytoplasm and nucleus were extracted using TRIzol. After reverse transcription, the expression levels of circBCBM1 in the cytoplasm and nucleus were detected by real-time fluorescent quantitative PCR. The RNA extraction and reverse transcription processes were the same. Example 1, the reaction system and conditions of real-time fluorescent quantitative PCR refer to Example 2, GAPDH is used as an internal reference gene.

[0088] The result is as image 3 As shown, the relative expression level of circBCBM1 in the nucleus is 7.16 times higher than that in the cytoplasm, indicating that the subcellular localization of circBCBM1 is mainly in the nucleus.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses cyclic RNA circBCBM1 and a primer of the cyclic RNA circBCBM1 and the like in a PCR (Polymerase Chain Reaction) amplification process. The cyclic RNA has high expression in a breast cancer brain metastasis cell and has moderate and low expression in other breast cancer cells and normal cells, and sub-cells are positioned in cell nucleuses; the cyclic RNA circBCBM1 disclosedby the invention appears in the lacking of breast cancer brain metastasis related cyclic RNA at present for the first time; the cyclic RNA circBCBM1 disclosed by the invention has a wide applicationspace in the aspects of breast cancer brain metastasis risk predication and a clinical diagnosis molecular marker, and a target spot of researching and developing a novel breast cancer brain metastasis medicine.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a circular RNA circBCBM1 and a non-diagnostic fluorescence quantitative detection method thereof. Background technique [0002] The incidence of tumor brain metastasis accounts for 9%-17%, and the mortality rate caused by it accounts for 20%. After lung cancer, breast cancer is the second solid malignancy that causes brain metastases. About 25% of patients with advanced breast cancer eventually develop brain metastases. Breast cancer brain metastases (BCBM) seriously affect patients' cognition, speech, motor coordination and quality of life. Brain metastasis of breast cancer has a high mortality rate and extremely poor prognosis. The median survival time of patients is only 6 months, and the 1-year survival rate is less than 20%. [0003] circRNA is a new type of ncRNA, which is formed by the reverse complementary pre-mRNA at the special end after variable shearing and head-to-tai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/113
CPCC12Q1/6886C12Q2600/158C12Q2600/178
Inventor付波刘伟安萌
OwnerLIAOCHENG PEOPLES HOSPITAL