A real-time fluorescent quantitative detection kit and detection method for HBV DNA in serum
A technology of real-time fluorescence quantification and detection kit, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., which can solve the problems of inability to accurately quantify HBVDNA, simple operation, and low manufacturing cost, so as to reduce medical waste The effect of generation, reduction of operation steps and improvement of accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Embodiment 1 A kind of real-time fluorescent quantitative detection kit A of HBV DNA in serum
[0081] The kit includes:
[0082] Detection primer set for hepatitis B virus HBV;
[0083] Detection probe for hepatitis B virus HBV;
[0084] and lysate;
[0085] The lysate comprises 5% (V / V) dodine, 6% (V / V) Tween-20, 20mM sodium citrate and 20mMNaCl;
[0086] The detection primer set of described hepatitis B virus HBV is made up of following primer sequence:
[0087] Primer sequence 1: GGCAACGGCCTGGTCTGTGCCAAGTGT,
[0088] Primer sequence 2: GGCAACGGTCAGGTCTCTGCCAAGTGT,
[0089] Primer sequence 3: TGACGCAACCCCCACTG,
[0090] Primer sequence 4: GCTGCGAGCAAAACAAG,
[0091] Primer sequence 5: GCGCAGGATCCAGTTGGCAGCACA,
[0092] Primer sequence 6: GTCCCGCGCAGGATCCAGTTGGCAGC;
[0093] The detection probe sequence of the hepatitis B virus HBV is: CCGATCCATACTGCGGAACT;
[0094] The fluorescent group labeled at the 5' end of the detection probe sequence of the hepatitis ...
Embodiment 2
[0105] Embodiment 2 A kind of real-time fluorescent quantitative detection kit B of HBV DNA in serum
[0106] Compared with the real-time fluorescent quantitative detection kit A in Example 1, the only difference of the real-time fluorescent quantitative detection kit B in this example is that 25% (V / V) Dodine is used in the lysate.
Embodiment 3
[0107] Embodiment 3 A kind of real-time fluorescent quantitative detection method of HBV DNA in serum
[0108] This embodiment adopts the real-time fluorescent quantitative detection kit A in the embodiment 1 to carry out real-time fluorescent quantitative detection of HBV DNA in serum;
[0109] The real-time fluorescence quantitative detection method comprises the following steps:
[0110](1) Acquisition of serum HBV DNA samples:
[0111] a. Shake the serum test tube for 10 seconds, mix thoroughly, and immediately transfer 200 μL to a 1.5 mL sterilized centrifuge tube, then add 20 μL magnetic beads, 20 μL carrier RNA, and 300 μL lysate, mix by inversion, and incubate at 50°C with shaking 6 minutes;
[0112] b. Transfer the centrifuge tube to the magnetic stand for 6 minutes to collect the magnetic beads, and discard the supernatant;
[0113] c. Briefly centrifuge to collect the liquid droplets on the tube wall, transfer the centrifuge tube to the magnetic stand for 1 minut...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com