Recombinant adeno-associated virus expressing IL-4 and preparation method and application thereof
A virus, -il-4-eyfp-wpre-pa technology, applied in the field of neurobiology, can solve problems such as treatment difficulties
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0040] The present invention also provides a method for preparing the above-mentioned recombinant adeno-associated virus, comprising the following steps:
[0041] 1) Clone the IL-4 gene;
[0042] 2) Respectively double-digesting the IL-4 gene and the Ef1α-EYFP-WPRE-pA plasmid obtained in step 1) to obtain the enzyme-digested IL-4 gene and the enzyme-digested Ef1α-EYFP-WPRE-pA plasmid;
[0043] 3) connecting the enzyme-cut IL-4 gene obtained in step 2) with the enzyme-cut Ef1α-EYFP-WPRE-pA plasmid to obtain the Ef1α-IL-4-EYFP-WPRE-pA plasmid;
[0044] 4) Transform the Ef1α-IL-4-EYFP-WPRE-pA plasmid obtained in step 3) into competent cells, perform amplification and culture, and obtain the amplified recombinant Ef1α-IL-4-EYFP-WPRE-pA plasmid;
[0045] 5) Transfect host cells with the amplified recombinant Ef1α-IL-4-EYFP-WPRE-pA plasmid obtained in step 4), and culture after transfection to construct a recombinant adeno-associated virus.
[0046] In the present invention, the ...
Embodiment 1
[0077] Cloning of IL-4 gene
[0078] (1) The spleen of C57BL / 6 mice was taken out under sterile conditions, and the total RNA was extracted by Trizol method;
[0079] (2) Reverse transcribe the extracted total RNA to synthesize the first-strand cDNA template according to the procedure in the instruction manual of the reverse transcription kit;
[0080] (3) According to mouse IL-4 gene sequence and BamH I and Xho I double restriction restriction cloning site, design the primer of the PCR of IL-4:
[0081] Upstream primer: CGCGGATCCATGGGTCTCAACCCCCAG (SEQ ID NO.1)
[0082] Downstream primer: CCGCTCGAGCTACGAGTAATCCATTTGCAT (SEQ ID NO.2)
[0083] (4) Add 2 μL of cDNA template, 2 μL of upstream primer, 2 μL of downstream primer, 15 μL of 2x TransTaq HiFiPCR SuperMix and 9 μL of ddH2O into a 200 μL EP tube, and perform PCR reaction to amplify IL-4 gene according to the following cycle conditions : Enzyme activation at 95°C for 3min; denaturation at 95°C for 10s; extension at 72°C...
Embodiment 2
[0088] Ligation and Transformation Amplification of IL-4 Gene and Vector pAAV Plasmid
[0089] (1) Measure the concentration of the isolated and purified IL-4 gene with a spectrophotometer, and use ddH 2 O the IL-4 gene was diluted to 40ng / μL;
[0090] (2) Purchase a plasmid carrying Ef1α-EYFP-WPRE-pA from Hanheng Company, mix the plasmid vector with competent Escherichia coli at a ratio of 10:1, bathe in water at 37°C for 20min, then heat shock in waterbath at 42°C for 30s, Add 250 μL of SOC medium, shake at 200 rpm, and incubate at 37° C. for 1 h. Take 200 μL of bacterial liquid and spread it on LB solid medium for culture. After culturing at 30°C for 24 hours, pick a single colony and inoculate it into 15ml of LB liquid medium containing 2ml of antibiotics, cultivate overnight at 30°C on a shaker, and add the culture obtained Transfer to a 1.5ml centrifuge tube, centrifuge at 12000g for 30s at 4°C, discard the supernatant, and extract the target plasmid from the obtained ...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com