Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant adeno-associated virus expressing IL-4 and preparation method and application thereof

A virus, -il-4-eyfp-wpre-pa technology, applied in the field of neurobiology, can solve problems such as treatment difficulties

Inactive Publication Date: 2018-11-30
UNIV OF ELECTRONIC SCI & TECH OF CHINA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Applying IL-4 protein to the treatment of depression still faces great difficulties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adeno-associated virus expressing IL-4 and preparation method and application thereof
  • Recombinant adeno-associated virus expressing IL-4 and preparation method and application thereof
  • Recombinant adeno-associated virus expressing IL-4 and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0040] The present invention also provides a method for preparing the above-mentioned recombinant adeno-associated virus, comprising the following steps:

[0041] 1) Clone the IL-4 gene;

[0042] 2) Respectively double-digesting the IL-4 gene and the Ef1α-EYFP-WPRE-pA plasmid obtained in step 1) to obtain the enzyme-digested IL-4 gene and the enzyme-digested Ef1α-EYFP-WPRE-pA plasmid;

[0043] 3) connecting the enzyme-cut IL-4 gene obtained in step 2) with the enzyme-cut Ef1α-EYFP-WPRE-pA plasmid to obtain the Ef1α-IL-4-EYFP-WPRE-pA plasmid;

[0044] 4) Transform the Ef1α-IL-4-EYFP-WPRE-pA plasmid obtained in step 3) into competent cells, perform amplification and culture, and obtain the amplified recombinant Ef1α-IL-4-EYFP-WPRE-pA plasmid;

[0045] 5) Transfect host cells with the amplified recombinant Ef1α-IL-4-EYFP-WPRE-pA plasmid obtained in step 4), and culture after transfection to construct a recombinant adeno-associated virus.

[0046] In the present invention, the ...

Embodiment 1

[0077] Cloning of IL-4 gene

[0078] (1) The spleen of C57BL / 6 mice was taken out under sterile conditions, and the total RNA was extracted by Trizol method;

[0079] (2) Reverse transcribe the extracted total RNA to synthesize the first-strand cDNA template according to the procedure in the instruction manual of the reverse transcription kit;

[0080] (3) According to mouse IL-4 gene sequence and BamH I and Xho I double restriction restriction cloning site, design the primer of the PCR of IL-4:

[0081] Upstream primer: CGCGGATCCATGGGTCTCAACCCCCAG (SEQ ID NO.1)

[0082] Downstream primer: CCGCTCGAGCTACGAGTAATCCATTTGCAT (SEQ ID NO.2)

[0083] (4) Add 2 μL of cDNA template, 2 μL of upstream primer, 2 μL of downstream primer, 15 μL of 2x TransTaq HiFiPCR SuperMix and 9 μL of ddH2O into a 200 μL EP tube, and perform PCR reaction to amplify IL-4 gene according to the following cycle conditions : Enzyme activation at 95°C for 3min; denaturation at 95°C for 10s; extension at 72°C...

Embodiment 2

[0088] Ligation and Transformation Amplification of IL-4 Gene and Vector pAAV Plasmid

[0089] (1) Measure the concentration of the isolated and purified IL-4 gene with a spectrophotometer, and use ddH 2 O the IL-4 gene was diluted to 40ng / μL;

[0090] (2) Purchase a plasmid carrying Ef1α-EYFP-WPRE-pA from Hanheng Company, mix the plasmid vector with competent Escherichia coli at a ratio of 10:1, bathe in water at 37°C for 20min, then heat shock in waterbath at 42°C for 30s, Add 250 μL of SOC medium, shake at 200 rpm, and incubate at 37° C. for 1 h. Take 200 μL of bacterial liquid and spread it on LB solid medium for culture. After culturing at 30°C for 24 hours, pick a single colony and inoculate it into 15ml of LB liquid medium containing 2ml of antibiotics, cultivate overnight at 30°C on a shaker, and add the culture obtained Transfer to a 1.5ml centrifuge tube, centrifuge at 12000g for 30s at 4°C, discard the supernatant, and extract the target plasmid from the obtained ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a recombinant adeno-associated virus expressing IL-4 and a preparation method and application thereof, and relates to the technical field of neurobiology. The recombinant adeno-associated virus expressing IL-4 comprises Ef1 alpha-IL-4-EYFP-WPRE-pA plasmids, can specifically express an IL-4 protein in the brain, and has a certain brain region specificity. After transfection of the mouse for 4 weeks, the RNA of the mouse brain is extracted and is subjected to real-time quantitative PCR. The results show that compared with the control group, the virus-injected group has higher protein concentrations of the IL-4 and IL-4 receptor. The overexpression of IL-4 can improve the behavioral despair, pleasure lack and depression of depressed mice and does not influence the weight of mice and thus it is proved that the recombinant adeno-associated virus is safe and non-toxic and can be used for preparation of drugs for treatment on depression.

Description

technical field [0001] The invention belongs to the technical field of neurobiology, and in particular relates to a recombinant adeno-associated virus expressing IL-4 and its preparation method and application. Background technique [0002] Depression is a mental disorder characterized by high morbidity, disability, suicide, low awareness and cure. Seriously affect the quality of life of patients, while bringing a greater economic burden to the society, but the pathogenesis of depression is still unclear. [0003] The current antidepressants have certain limitations. Most antidepressants are ineffective for about one-third of patients with depression, and they require a long treatment time. They are prone to relapse after drug withdrawal and have strong side effect. [0004] IL-4 is an anti-inflammatory cytokine produced by activated T cells, which plays an important role in the process of immune regulation. It has been found in antidepressant drug research that IL-4 has c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/864C12N15/66A61K38/20A61P25/24
CPCC12N7/00A61P25/24C07K14/5406C12N15/66C12N15/86C12N2750/14121C12N2750/14143
Inventor 游自立张进强张立娟贺慧
Owner UNIV OF ELECTRONIC SCI & TECH OF CHINA