A naked barley feruloyltyramine acyltransferase gene and uses thereof
A gene and gene fragment technology, which is applied in the application field of highland barley feruloyl tyramide acyltransferase gene, can solve problems such as unseen highland barley feruloyl tyramide, and achieve the effects of improving health care value and increasing value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Isolation and prokaryotic expression of HVUL4H14252 gene
[0034] This example is mainly about the method of HVUL4H14252 gene acquisition, vector construction and prokaryotic expression.
[0035] (1) Construction of gene fragments and vectors
[0036] Weigh 1 gram of fresh barley leaves, extract barley RNA, synthesize cDNA with M-MLV Reverse Transcriptase from Thermo Fisher Company, and design primers as follows:
[0037] F: CGCGGATCCATGGAGATGACGAGCAGCTCG
[0038] R:ATAAGAATGCGGCCGCTCAATCCAACGAGTAGCAGATCTGC
[0039] Perform PCR amplification to obtain fragments of the target band size. The PCR product was purified with a gel extraction kit (GelExtraction Kit D2500-02, OMEGA).
[0040] The nucleotide sequence (SEQ ID NO.1) of the amplified target fragment HVUL4H14252 gene is:
[0041]ATGGAGATGACGAGCAGCTCGATGGTGAAACCGGCGTACGCCGTGCCGCACCCGCTCGTCGGCGACAAGGTCCCGCTGACCGTCTTCGACCGCGCCGCCCTGGACATCTTCGTCCCCACCGTGCTCGCCTACCCCGCGCCGGCGCCGTCCAACGAGGCTCTCAGGGAAGGGCTCC...
Embodiment 2
[0057] The construction of embodiment 2 transgenic tobacco
[0058] ①Transform the transient expression vector containing the target gene (provided by Professor George Lomonossoff, John InnesCentre) into Agrobacterium (EHA105);
[0059] ②Pick positive Agrobacterium clones in 500ul LB containing corresponding antibiotics (kn), and culture them for 20-24 hours;
[0060] ③Transfer 200ul into 5ml LB containing the corresponding antibiotic (kn), shake at 28°C at 220rpm to OD=2.0.
[0061] ④ Centrifuge at 10000rpm at room temperature for 2 minutes to collect the bacteria, resuspend the bacteria with the transformation buffer prepared in advance, and shake on the shaker for 3 hours; the composition and concentration of the buffer working solution are as follows: 10mM MES (pH5.7), 10mM MgCl2, 100μM acetosyringone (acetosyringone, AS).
[0062] ⑤Take the prepared 1ml syringe, remove the needle, select a syringe with a smooth outlet to inhale the bacterial liquid, take the Nicotiana b...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap