Unlock instant, AI-driven research and patent intelligence for your innovation.

A naked barley feruloyltyramine acyltransferase gene and uses thereof

A gene and gene fragment technology, which is applied in the application field of highland barley feruloyl tyramide acyltransferase gene, can solve problems such as unseen highland barley feruloyl tyramide, and achieve the effects of improving health care value and increasing value.

Active Publication Date: 2018-12-18
AGRI RES INST TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There is no report of feruloyl tyramine in highland barley

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A naked barley feruloyltyramine acyltransferase gene and uses thereof
  • A naked barley feruloyltyramine acyltransferase gene and uses thereof
  • A naked barley feruloyltyramine acyltransferase gene and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Isolation and prokaryotic expression of HVUL4H14252 gene

[0034] This example is mainly about the method of HVUL4H14252 gene acquisition, vector construction and prokaryotic expression.

[0035] (1) Construction of gene fragments and vectors

[0036] Weigh 1 gram of fresh barley leaves, extract barley RNA, synthesize cDNA with M-MLV Reverse Transcriptase from Thermo Fisher Company, and design primers as follows:

[0037] F: CGCGGATCCATGGAGATGACGAGCAGCTCG

[0038] R:ATAAGAATGCGGCCGCTCAATCCAACGAGTAGCAGATCTGC

[0039] Perform PCR amplification to obtain fragments of the target band size. The PCR product was purified with a gel extraction kit (GelExtraction Kit D2500-02, OMEGA).

[0040] The nucleotide sequence (SEQ ID NO.1) of the amplified target fragment HVUL4H14252 gene is:

[0041]ATGGAGATGACGAGCAGCTCGATGGTGAAACCGGCGTACGCCGTGCCGCACCCGCTCGTCGGCGACAAGGTCCCGCTGACCGTCTTCGACCGCGCCGCCCTGGACATCTTCGTCCCCACCGTGCTCGCCTACCCCGCGCCGGCGCCGTCCAACGAGGCTCTCAGGGAAGGGCTCC...

Embodiment 2

[0057] The construction of embodiment 2 transgenic tobacco

[0058] ①Transform the transient expression vector containing the target gene (provided by Professor George Lomonossoff, John InnesCentre) into Agrobacterium (EHA105);

[0059] ②Pick positive Agrobacterium clones in 500ul LB containing corresponding antibiotics (kn), and culture them for 20-24 hours;

[0060] ③Transfer 200ul into 5ml LB containing the corresponding antibiotic (kn), shake at 28°C at 220rpm to OD=2.0.

[0061] ④ Centrifuge at 10000rpm at room temperature for 2 minutes to collect the bacteria, resuspend the bacteria with the transformation buffer prepared in advance, and shake on the shaker for 3 hours; the composition and concentration of the buffer working solution are as follows: 10mM MES (pH5.7), 10mM MgCl2, 100μM acetosyringone (acetosyringone, AS).

[0062] ⑤Take the prepared 1ml syringe, remove the needle, select a syringe with a smooth outlet to inhale the bacterial liquid, take the Nicotiana b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a naked barley feruloyltyramine acyltransferase gene HVUL4H14252. The invention further provides a preparing method of a recombinant vector, a recombinant bacterium, and a transgenic plant which contain the gene. The invention further provides feruloyltyramine acyltransferase and a preparing method thereof. The feruloyltyramine acyltransferase can be used for synthesizing atraditional Chinese medicine substance that is feruloyltyramine and has a good application prospect.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the application of a highland barley feruloyl tyrosyl transferase gene. Background technique [0002] The active ingredient of traditional Chinese medicine, feruloyl tyramide, has the functions of scavenging free radicals and antioxidation, and also has antibacterial, melanin synthesis, and insulin secretion stimulating activities. At present, feruloyl tyramide is mainly extracted from traditional Chinese medicines such as Shimanzi and Digupi. Due to the limited natural resources of traditional Chinese medicine, only relying on direct extraction cannot meet people's long-term needs. [0003] Highland barley, English name of highland barley: hulless barley is a kind of cereal crop of Poaceae Barley. Because of the separation of inner and outer glumes and bare kernels, it is also called naked barley, yuan wheat, and rice barley. It is mainly produced in China's Tibet, Qinghai, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/70C12N1/21C12N9/10A01H5/00A01H6/46A01H6/82C12R1/19
CPCC12N9/1029C12N15/8243C12Y203/0111
Inventor 曾兴权徐齐君王玉林原红军扎桑韦泽秀顿珠加布杨春葆于明寨尼玛扎西
Owner AGRI RES INST TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More