Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker of female flower regulating gene g in muskmelon and its application

A muskmelon and g gene technology, applied in the field of agricultural biology, can solve the problems of time-consuming, labor-intensive and complicated breeding of all females, and achieve the effects of improving the breeding effect, saving time and cost, and clearing the breeding selection goals.

Active Publication Date: 2019-01-25
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the sex type inheritance of muskmelon is relatively complicated, the genotype of the all female line is AAgg. During the breeding process of the all female line, the A gene is dominant and can still be observed through contemporary phenotypes, while the g gene is recessive and can only be observed automatically. Observing the phenotype of the offspring, therefore, it is laborious and laborious to select and breed all female lines by conventional crossing methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of female flower regulating gene g in muskmelon and its application
  • Molecular marker of female flower regulating gene g in muskmelon and its application
  • Molecular marker of female flower regulating gene g in muskmelon and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1. Development of g gene-specific markers and detection of offspring populations

[0051] 1. Development of g gene-specific markers

[0052] The marker g-FR is designed according to the location of the g gene, and the marker is composed of the primer shown in sequence 1 and the primer shown in sequence 2, which is a g gene-specific marker.

[0053] Primer F: AAGGTACTCCAAATGAATGGCT (SEQ ID NO: 1);

[0054] Primer R: TTAAATCGGGTCGGTTCGGT (SEQ ID NO: 2).

[0055] 2. Establishment of g gene-specific marker detection method

[0056] Melon material B15 is an all-hermaphroditic flowering plant type, and the whole plant only bears one type of complete flowers. The genotype has been identified as aagg, that is, it contains the g gene.

[0057] The melon material 054 is a male whole plant type, with male flowers attached to the main vine, male flowers and complete flowers attached to the side branches, and the genotype has been identified as aaGG, that is, it contains ...

Embodiment 2

[0088] Example 2, the application of marker g-FR in identifying the distribution of g gene in melon germplasm resources

[0089]In order to identify new all-hermaphroditic flower resources and understand the distribution of the g gene, 34 melon resources shown in Table 1 were detected by PCR using g-FR markers. The unisexual flower materials 1520A and B24 (Hefei Pangzi Agricultural Products Co., Ltd.) (known genotype as GG) were used as controls.

[0090] If a PCR amplification product of 100-200bp is obtained, the offspring of the melon to be tested contains or is candidate to contain the g gene; if no PCR amplification product of 100-200bp is obtained, the offspring of the melon to be tested does not contain or the candidate does not contain the g gene.

[0091] The result is as image 3 and as shown in Table 1, image 3 Among them, lanes 1-36 are: melon materials B15, B18, 054, B1, B2, B3, B4, B5, B6, B7, B8, B9, B10, B11, B12, B13, B14, B16, B17, B19 , HP1, HP2, HP3, HP...

Embodiment 3

[0098] Embodiment 3, the application of marker g-FR in cultivating all female lines of muskmelon

[0099] In order to rapidly breed all-female lines of melon with genotype AAgg, conventional sexual hybridization and backcross breeding methods were adopted, supplemented by molecular marker selection of g gene.

[0100] 1. Parent selection

[0101] Melon B15 (a litter of monkeys, Zhengzhou Xingyuan Seed Industry Co., Ltd.), hermaphrodite flower material, genotype is aagg, providing g gene; B8 (crown horn, Jingyan Yinong (Beijing) Seed Industry Technology Co., Ltd.), male flowers Hermaphrodite flower material, genotype is aaGG, reincarnation parent; B24 (Huangzi Jinyu, Hefei Pangzi Agricultural Products Co., Ltd.), monoecious (unisexual flower) material, genotype is AaGG, and A gene is provided.

[0102] 2. The all-female line breeding method with muskmelon B8 as the genetic background

[0103] Firstly, F 1 Generation seeds, planted F 1 For the generation plant, pull out the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker of a female flower regulating gene g of a muskmelon and an application thereof. A prim pair of the invention is a primer pair capable of amplifying a targetsequence; the target sequence is 1) or 2) as follows: 1) a single-stranded DNA molecule shown in SEQ ID NO:3 of a sequence table; 2) a DNA molecule of SEQ ID NO:3 which is substitute and / or deleted and / or added by one or several nucleotides and has the same function as SEQ ID NO:7. The invention utilizes the molecular marker and the corresponding primer to carry out polymerase chain reaction on the total DNA of the genome of the muskmelon, and after the amplification product is subjected to electrophoresis detection, it can be judged whether the individual plant to be detected carries the g gene, the band specificity is good, the accuracy rate of the result is high, and the detection is not influenced by the environment and the genetic background. The invention can be used for screening and identifying female flower regulating gene g in a large number of muskmelon germplasm resources, can be used for breeding muskmelon whole female line, and can be used for molecular marker assisted selection breeding and gene polymerization breeding.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to a molecular marker of the melon female flower regulation gene g and an application thereof. Background technique [0002] Melon (Cucumis melo L.) is an annual herbaceous plant of Cucurbitaceae Cucumis genus Cucumis. Because of its sweet fruit and rich nutrition, it is loved by people all over the world. There are sex differentiation in melon, and there are three main flower types: male flowers, female flowers and complete flowers. The combination of different flower types makes the sexual types of melons more abundant, which can be roughly divided into the following types: andromonoecious (andromonoecious), gynomonoecious, dioecious Monoecious (monoecious), hermaphrodite (hermaphrodite), androecious (trimonoecious), gynoecious, androecious (androecious) Luan Feishi et al., 2013). [0003] Studies have shown that the sex type of melon is mainly affected by ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11A01H1/02A01H1/04
CPCA01H1/02A01H1/04C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王建设马建
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com