Unlock instant, AI-driven research and patent intelligence for your innovation.

A protein controlling sporulation and infection ability of blast fungus oryzae

A rice blast fungus and protein technology, applied in fungi, microbial-based methods, peptides, etc., can solve the problems of rice production reduction and rice harvest failure

Active Publication Date: 2020-10-09
BEIJING UNIV OF AGRI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under normal circumstances, rice blast damage can reduce rice production by 5-10%, and even lead to rice crop failure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A protein controlling sporulation and infection ability of blast fungus oryzae
  • A protein controlling sporulation and infection ability of blast fungus oryzae
  • A protein controlling sporulation and infection ability of blast fungus oryzae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Acquisition of Proteins and Genes Encoding the Controlling Sporulation and Infection Ability of Magnaporthe grisea

[0040] The inventors of the present invention found a protein that controls the spore production and infectivity of Magnaporthe grisea by screening random insertion mutants, which is derived from Magnaporthe grisea strain P131 and can be obtained according to the following method:

[0041] 1. Cloning of cDNA fragments (sequence 3 in the sequence listing)

[0042] Specific primers were designed as follows:

[0043] F (5' end): GC CATATG GCGACCAACGGCGAAACGCCCA

[0044] R (3' end): GC GAATTC ATGTCCTCT TGCATCCGATCTGCT

[0045] The first-strand cDNA obtained by reverse transcription with random primers of Magnaporthe oryzae P131 was used as a template, and F and R were used as primers, and the final concentration was 10 μmol / L, and PCR amplification was carried out in a 25 μl reaction system. The amplification program was: pre-denaturation at 95°C ...

Embodiment 2

[0054] Example 2. Proof of the role of the gene MGG-01427 controlling the spore production and infection ability of Magnaporthe grisea in the present invention on the spore production of Magnaporthe grisea

[0055] The present invention uses gene knockout experiments and gene complementation experiments to prove the effect of MGG-01427 on the spore production of Magnaporthe grisea. This part includes the construction of the knockout vector and the complementary vector, the transformation of the rice blast fungus protoplast, the acquisition of the corresponding transformant, and the determination of the spore production.

[0056] 1. Construction of knockout vector

[0057] The construction of the knockout vector refers to joining a piece of DNA sequence located on both sides of the gene coding region into a vector, and the hygromycin gene is used to separate the two. Through the homologous recombination of the flanking sequences on both sides of the gene and the corresponding ...

Embodiment 3

[0084] Example 3, Knockout 1427KO2 of Gene MGG-01427 Affects Infection Ability of Magnaporthe grisea

[0085] 1. Inoculation of isolated barley leaves with mycelium blocks

[0086] Use a scalpel to cut out the new mycelial blocks of wild-type P131 and knockout 1427KO2 respectively. The size of the mycelial block is about 2mm×2mm, and the mycelium faces down. They are inoculated with scratched barley leaves respectively. Observed after 5 days of alternate cultivation.

[0087] 2. The knockout 1427KO2 of the gene MGG-01427 has a reduced ability to infect M. oryzae

[0088] The barley leaves infected by wild-type P131 and knockout 1427KO2 were collected respectively, and the hyphae infection status was observed by optical microscope. It was found that the ability of the knockout 1427KO2 to infect and elongate the invasive hyphae in barley leaf cells was lower than that of the wild-type P131, as shown in Figure 6 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein for controlling the sporulation quantity and infectivity of magnaporthe grisea and a coding gene thereof. The protein is a protein as shown in 1) or 2) as follows: 1)a protein composed of amino acid residue sequence as shown in SEQ ID No.1 in the sequence table; and 2) a protein which is derived from SEQ ID No: 1 through substitution and / or deletion and / or addition of one or several amino acid residues of the amino acid residue sequence as shown in the SEQ ID No.1 in the sequence table and has related protein functions of controlling sporulation quantity andinfectivity of magnaporthe grisea. Knockout of the coding gene of the protein results in a decrease in the sporulation quantity of magnaporthe grisea and a decrease in the infectivity of the infectious hyphae. The sporulation quantity of the knock-out decreased to about 34% of the sporulation quantity of wild-type P131.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention relates to a protein and its coding gene for controlling the spore production and infection ability of rice blast fungus. Background technique [0002] Magnaporthe oryzae is a fungus belonging to the subphylum Ascomycota, which can infect rice, wheat, barley and other grasses, causing blast. In general, rice blast damage can reduce rice production by 5-10%, and even lead to rice crop failure. Rice blast is one of the main diseases of rice in my country, and it is also a worldwide rice disease. [0003] Magnaporthe oryzae uses conidia as the source of primary infection and re-infection of host plants. The conidia of Magnaporthe oryzae are pear-shaped and consist of three cells. Under suitable conditions, the conidia adsorbed on the leaves germinate to form appresses, and the mature appresses produce infection nails that directly penetrate the epidermal cells of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/37C12N15/31C12N1/15C12R1/645
CPCC07K14/37
Inventor 王维香殷悦周思达赵新玉崔丽娥张梦玉
Owner BEIJING UNIV OF AGRI