A protein controlling sporulation and infection ability of blast fungus oryzae
A rice blast fungus and protein technology, applied in fungi, microbial-based methods, peptides, etc., can solve the problems of rice production reduction and rice harvest failure
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1. Acquisition of Proteins and Genes Encoding the Controlling Sporulation and Infection Ability of Magnaporthe grisea
[0040] The inventors of the present invention found a protein that controls the spore production and infectivity of Magnaporthe grisea by screening random insertion mutants, which is derived from Magnaporthe grisea strain P131 and can be obtained according to the following method:
[0041] 1. Cloning of cDNA fragments (sequence 3 in the sequence listing)
[0042] Specific primers were designed as follows:
[0043] F (5' end): GC CATATG GCGACCAACGGCGAAACGCCCA
[0044] R (3' end): GC GAATTC ATGTCCTCT TGCATCCGATCTGCT
[0045] The first-strand cDNA obtained by reverse transcription with random primers of Magnaporthe oryzae P131 was used as a template, and F and R were used as primers, and the final concentration was 10 μmol / L, and PCR amplification was carried out in a 25 μl reaction system. The amplification program was: pre-denaturation at 95°C ...
Embodiment 2
[0054] Example 2. Proof of the role of the gene MGG-01427 controlling the spore production and infection ability of Magnaporthe grisea in the present invention on the spore production of Magnaporthe grisea
[0055] The present invention uses gene knockout experiments and gene complementation experiments to prove the effect of MGG-01427 on the spore production of Magnaporthe grisea. This part includes the construction of the knockout vector and the complementary vector, the transformation of the rice blast fungus protoplast, the acquisition of the corresponding transformant, and the determination of the spore production.
[0056] 1. Construction of knockout vector
[0057] The construction of the knockout vector refers to joining a piece of DNA sequence located on both sides of the gene coding region into a vector, and the hygromycin gene is used to separate the two. Through the homologous recombination of the flanking sequences on both sides of the gene and the corresponding ...
Embodiment 3
[0084] Example 3, Knockout 1427KO2 of Gene MGG-01427 Affects Infection Ability of Magnaporthe grisea
[0085] 1. Inoculation of isolated barley leaves with mycelium blocks
[0086] Use a scalpel to cut out the new mycelial blocks of wild-type P131 and knockout 1427KO2 respectively. The size of the mycelial block is about 2mm×2mm, and the mycelium faces down. They are inoculated with scratched barley leaves respectively. Observed after 5 days of alternate cultivation.
[0087] 2. The knockout 1427KO2 of the gene MGG-01427 has a reduced ability to infect M. oryzae
[0088] The barley leaves infected by wild-type P131 and knockout 1427KO2 were collected respectively, and the hyphae infection status was observed by optical microscope. It was found that the ability of the knockout 1427KO2 to infect and elongate the invasive hyphae in barley leaf cells was lower than that of the wild-type P131, as shown in Figure 6 shown.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


