Construction method of rice transcription factor oshrs1 mutant and its application in rice drought stress
A technology of rice transcription factor and mutant, applied in the construction of rice transcription factor OsHRS1 mutant, the application field of rice drought stress, can solve the problem that abiotic stress is not reported and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Rice Transcription Factors OsHRS1 Nucleotide sequence and amino acid sequence acquisition
[0041] Log in to the homepage of the Rice Database Center (http: / / www.ricedata.cn / gene / ), and search for it according to its LOC_Os03g55590 OsHRS1 Nucleotide sequence and amino acid sequence. Reference sequence such as figure 1 shown.
Embodiment 2
[0042] Example 2: Rice Transcription Factors OsHRS1 subcellular localization of
[0043] Through the multiple cloning site of pEXT06 / g empty vector sequence, in the target gene OsHRS1 A forward primer and a reverse primer were designed at both ends of the CDS region of the pEXT06 / g vector, and the pEXT06 / g vector has a GFP tag, which shows green under fluorescence. The primers are as follows (the bold is the vector sequence, and the following is the first and last ends of the CDS region of the target gene):
[0044] OsHRS1 -GFP-F: 5' tcagcagtcgaagagcATGGGGCTGGACGTGGGGGA 3' (SEQ ID NO. 6)
[0045] OsHRS1 -GFP-R: 5' TTAGCGTGTGAAGAGCTTTTCGGACATAGCCTTCC 3' (SEQ ID NO. 7)
[0046] Obtained by PCR OsHRS1 For the fragment with the vector sequence, a DNA fragment of about 1259 bp was recovered using a DNA recovery kit, and this fragment was connected to the corresponding pEXT06 / g vector by homologous recombination. The obtained vector was named pEXT06 / g-HRS1. Agrobacterium GV3...
Embodiment 3
[0054] Example 3: OsHRS1 Identification of positive plants of the knockout material T0 generation
[0055] Amplified from rice Nipponbare total cDNA by RT-PCR OsHRS1 Gene full-length cDNA (open reading frame part). The first-strand synthesis was performed according to the instructions of Roche's Revert Aid TM First Strand cDNA Synthesis Kit. according to OsHRS1 The following primers were designed for the sequence of the gene, F: 5'-ACCCTTCCTCCAGTTCTTG -3' (SEQ ID NO.1) and R: 5'- TCCACGAGCACGATCTTTC -3' (SEQ ID NO.2) were RT-PCR primers, which were carried out by RT-PCR For cDNA amplification, the amplification conditions were: 95°C preheating for 3 min; 95°C for 10 s, 60°C for 30 s, 72°C for 2 min, a total of 35 cycles; 72°C for 10 min. After PCR, electrophoresis analysis was performed, and the amplified fragment of about 1700 bp was recovered using the gel recovery kit of Kangwei Century Company. Connect the gel recovered fragments to T vectors to transform competent c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More