Recombinant expression plasmid vector for producing fucose-based lactose, metabolic engineering bacteria, and production method

A technology for expressing plasmids and expression vectors, which is applied in the fields of metabolic engineering and food fermentation, and can solve problems such as undiscovered, restricted, inhibited bacterial growth, substrate conversion rate, product yield, etc.

Active Publication Date: 2019-03-01
JIANGSU UNIV
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, during the fermentation process of Escherichia coli, it is easy to accumulate by-products such as acetic acid, which seriously inhibits the growth of bacteria, substrate conversion rate and product yield; in addition, the addition of a certain concentration of antibiotics and the production of endotoxins during the cultivation of Escherichia coli severely limit human Milk oligosaccharides as nutritional fortifiers in the field of development and application of infant products
[0004] At present, there is no report on the fermentation of human milk oligosaccharides by recombinant bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression plasmid vector for producing fucose-based lactose, metabolic engineering bacteria, and production method
  • Recombinant expression plasmid vector for producing fucose-based lactose, metabolic engineering bacteria, and production method
  • Recombinant expression plasmid vector for producing fucose-based lactose, metabolic engineering bacteria, and production method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1: the construction of recombinant engineered bacterium producing 2'-fucosyllactosyl glutamicum

[0044] The gene encoding superoxide dismutase (Superoxide dismutase) existing in Corynebacterium glutamicum sod The promoter expresses each gene ( sod Promoter, gmd Gene, wxya Gene, lac Y Gene, f gene), expression can be achieved without the addition of an inducer. Using overlap extension PCR, the sod The promoter sequence is fused with the gene of interest to be expressed.

[0045] (1) Using the Corynebacterium glutamicum genome (NCBI accession number: GCA_000011325.1) as a template, design primers:

[0046] Upstream primer sod-gmdF1 (SEQ ID NO.10): AAAACTGCAGtagctgccaattattccggg

[0047] Downstream primer sodR (SEQ ID NO .11): GGGTAAAAAATCCTTTCGTAGG;

[0048] PCR amplification sod promoter sequence.

[0049] Using the Escherichia coli BL21 genome (accession number: GCA_000833145.1) as a template, design primers:

[0050] Upstream primer sod-g...

Embodiment 2

[0088] Example 2: Production of 2'-fucosyllactose by fermentation of recombinant Corynebacterium glutamicum CgdGYC shake flask with glucose as carbon source

[0089] (1) Seed medium: glucose 5.0g / L, nitrogen source and trace elements: 1.0 g / L yeast extract, 2.0g / L NH 4 Cl, 10.0 g / L Na 2 HPO 4 ·7H 2 O, 3.0 g / L KH 2 PO 4 , 0.5 g / L NaCl, 0.25 g / L MgSO 4 ·7H 2 O, 15.0 mg / L CaCl 2 2H 2 O, 10 mg / L vitamin B1.

[0090] Fermentation medium: glucose 50.0g / L, nitrogen source and trace elements: 2.0 g / L yeast extract, 2.0 g / L NH 4 Cl, 10.0 g / L Na 2 HPO 4 ·7H 2 O, 3.0 g / L KH 2 PO 4 , 0.5 g / L NaCl, 0.25 g / L MgSO 4 ·7H 2 O, 15.0 mg / L CaCl 2 2H 2 O, 10 mg / L Vitamin B1, 0.1% (v / v) Triton-X 100.

[0091] (2) Pick a single colony of the recombinant strain Corynebacterium glutamicum CgdGYC in the seed solution with a liquid volume of 100mL, 30 o C, 180 r / min rotary shaker culture to OD 562 ≈10.0 as seed solution.

[0092] (3) Inoculate the seed solution of the recombinant s...

Embodiment 3

[0093] Embodiment 3: in the enhanced expression Corynebacterium glutamicum man A , man B with manC Gene expression enhances the production of 2'-fucosyllactose in recombinant Corynebacterium glutamicum

[0094] The phosphomannose isomerase gene required for the enhanced synthesis of 2'-fucosyllactose or 3-fucosyllactose involved in this example man A (The nucleotide sequences are respectively shown in SEQ ID NO.7), phosphomannose mutase gene man B (The nucleotide sequences thereof are respectively shown in SEQ ID NO.8) and mannose-1-phosphate guanine base transferase gene manC (Its nucleotide sequence is respectively shown in SEQ ID NO .9) is all in the genome of Corynebacterium glutamicum itself 。

[0095] (1) sod promoter sequence and man A Gene sequence acquisition: using the Corynebacterium glutamicum genome as a template, design the upstream primer sod-manAF1 (SEQ ID NO .23): TCCCCCGGGTAGCTGCCAATTATTCCGGG and the downstream primer sodR: GGGTAAAAAATCCTTTCGTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant expression plasmid vector for producing fucose-based lactose, metabolic engineering bacteria, and a production method and belongs to the fields of metabolic engineering, food fermentation and the like. In the invention, genes for encoding GDP-mannose-6-dehydrogenase, GDP-fucose synthetase, lactose permease, and alpha-1,2-fucose transferase or alpha-1,3-fucosetransferase, which are required in a de-novo synthesis route of the fucose-based lactose, are expressed in corynebacterium glutamicum, so that recombinant corynebacterium glutamicum is constructed toachieve synthesis of 2'-fucose-based lactose or 3'-fucose-based lactose. In addition, by over-expression of the genes for encoding phosphomannose isomerase, phosphomannose mutase, and mannose-1-phosphate guanylyltransferase in the corynebacterium glutamicum, high yield of the fucose-based lactose is achieved. According to the method, the engineering bacteria can synthesize the fucose-based lactose by means of glucose or glycerol, has advantages of high growth speed and good safety, and has significant industrial potential.

Description

technical field [0001] The invention relates to a fucosyllactose-producing recombinant expression plasmid carrier, a metabolic engineering bacterium and a production method, and belongs to the fields of metabolic engineering and food fermentation technology. Background technique [0002] 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL) are the most abundant types of fucosyl in human milk Oligosaccharides. Studies have shown that stage of lactation and geographical distribution significantly affect secreted 2'-FL concentrations in milk. For example, a survey of 435 women in 10 countries found that 78% of Chinese mothers' milk contained secreted 2'-FL, while only 46% of Philippine mothers' milk contained secreted 2'-FL. At present, the management departments of the United States, the European Union and China have regulated the safety, applicability and dosage of human milk oligosaccharides. [0003] Generally, human milk oligosaccharides can be produced by separation a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/77C12N1/21C12P19/12C12R1/15
CPCC12N9/1241C12N9/90C12N15/77C12P19/12C12Y207/07013C12Y503/01008C12Y504/02008
Inventor崔凤杰满再伟孙文敬
OwnerJIANGSU UNIV