Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of Escherichia coli with acid-resistant high-density growth and its application

A technology for Escherichia coli, which is used in the field of microorganisms, can solve the problem of low density of Escherichia coli and achieve the effect of prolonging the logarithmic growth phase

Active Publication Date: 2021-10-22
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Designed to address the low density of existing Escherichia coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Escherichia coli with acid-resistant high-density growth and its application
  • A kind of Escherichia coli with acid-resistant high-density growth and its application
  • A kind of Escherichia coli with acid-resistant high-density growth and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Acquisition, Identification and Preservation of Escherichia coli S17-3

[0043] Escherichia coli S17-3 is a mutant strain of Escherichia coli S17-1, a model Escherichia coli S17-1 that is used in laboratories all over the world. Both natural and random mutations may cause changes in the traits of microorganisms. Changes in the culture performance of the strain, as well as subsequent genome sequencing and comparison, have confirmed that mutations at multiple gene sites have occurred, and were preserved in the China Center for Type Culture Collection on April 16, 2018, with the preservation number of CCTCC 2018200.

[0044] The Escherichia coli species Escherichia coli S17-3 isolated by the present invention has short bacilli with blunt ends and a size of about 0.5-3.0um, and has round colonies with milky white and smooth surface, and the edges of the colonies are neat. , grow rapidly in medium rich in glucose as carbon source.

[0045] After morphological id...

Embodiment 2

[0050] The construction method of embodiment 2 Escherichia coli S17-3 high-density growth system

[0051] a. Construction of recombinant plasmids pETACAB and pBhya-CAB

[0052] The map of the constructed recombinant plasmid pETACAB is as follows Figure 1A shown. First cut out the 3870bp fragment (the nucleotide sequence of the 3870bp fragment is shown in SEQ ID NO.1, specifically as :

[0053]tatggcacgtctctcctccttgcgacaccggcaggacaccgggcgcttatggtcggcaagcgacgtccctgtagcaaggcaaaccatcgcttcacgtgagatgctgaaaacgaaagctcatccttctgcactggcgcacgtcgccagaaagtattgttaataaagcgtagtgaaacttttgcacaaaacaatacaaactgtgtggatttatcttttagcgataaaaatggacctatttttcttttggccgggcggtggggatgtttagccggttgctaaacgagtaaaagagaaggaattcggatcctagagggaaaccgttgtggtctccctatagtgagtcgtattaatttcgcgggatcgagatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcagcgccc...

Embodiment 3

[0101] Example 3 Schematic diagram of E. coli S17-3 high-density growth over time

[0102] Shake flask fermentation of the recombinant Escherichia coli BW25113 / pETACAB, BW25113 / pBhya-CAB, S17-3 / pETACAB, S17-3 / pBhya-CAB obtained by electroporation in Example 2: pick Escherichia coli S17-3 with an inoculation loop / pBhya-CAB was inoculated into a test tube filled with 3ml LB, cultured overnight at 37°C on a shaker at 200r / min. Inoculate overnight cultured E. coli into a 500mL shake flask containing 100mL liquid LB medium at an inoculum size of 1%, add 20g / L glucose and 100ul of 100ug / ml ampicillin antibiotics to the medium, and also incubate at 37°C , 200r / min shaker for fermentation. The initial pH of the medium was controlled at around pH 7.0. Fermentation 24h sampling measurement cell growth density OD 600 . figure 2 The cell density OD was obtained by fermenting four strains of recombinant Escherichia coli for 24 hours. 600 . from figure 2 It can be observed that th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an acid-resistant high-density Escherichia coli and its application, the Escherichia coli species Escherichia coli The deposit number of S17-3 is: CCTCC 2018200. Escherichia coli species mentioned above Escherichia coli In the culture medium, S17‑3 can naturally extend the logarithmic growth phase of Escherichia coli without additional fermentation control, and can make the cell density OD during the overnight culture period 600 The value reaches more than 30, which is more than three times that of other Escherichia coli, and provides an important host cell for the economical and efficient high-density fermentation production of Escherichia coli.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to an acid-resistant high-density Escherichia coli and its application. Background technique [0002] With the development of bioengineering technology, more and more microbial fermentation methods are applied to the production of chemicals, enzyme proteins and pharmaceuticals. Among them, Escherichia coli has become an ideal host cell in industry due to its many advantages such as easy cultivation, rapid growth, simple operation, low cost, clear genetic background and no safety problems. The industrial realization of high-density fermentation is an important prerequisite for the production of various economically valuable compounds by E. coli fermentation. The successful expression of exogenous genes by using molecular biology techniques is the first step to achieve large-scale production of target products. In order to truly realize the mass production of the target pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C12N15/70C12N1/21C12P19/04C12R1/19
CPCC12N15/70C12P19/04C12N1/205C12R2001/19
Inventor 孙俊松吴海英纪明华凌喆陈桥史吉平李久盛
Owner SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI