A kind of Escherichia coli with acid-resistant high-density growth and its application
A technology for Escherichia coli, which is used in the field of microorganisms, can solve the problem of low density of Escherichia coli and achieve the effect of prolonging the logarithmic growth phase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Acquisition, Identification and Preservation of Escherichia coli S17-3
[0043] Escherichia coli S17-3 is a mutant strain of Escherichia coli S17-1, a model Escherichia coli S17-1 that is used in laboratories all over the world. Both natural and random mutations may cause changes in the traits of microorganisms. Changes in the culture performance of the strain, as well as subsequent genome sequencing and comparison, have confirmed that mutations at multiple gene sites have occurred, and were preserved in the China Center for Type Culture Collection on April 16, 2018, with the preservation number of CCTCC 2018200.
[0044] The Escherichia coli species Escherichia coli S17-3 isolated by the present invention has short bacilli with blunt ends and a size of about 0.5-3.0um, and has round colonies with milky white and smooth surface, and the edges of the colonies are neat. , grow rapidly in medium rich in glucose as carbon source.
[0045] After morphological id...
Embodiment 2
[0050] The construction method of embodiment 2 Escherichia coli S17-3 high-density growth system
[0051] a. Construction of recombinant plasmids pETACAB and pBhya-CAB
[0052] The map of the constructed recombinant plasmid pETACAB is as follows Figure 1A shown. First cut out the 3870bp fragment (the nucleotide sequence of the 3870bp fragment is shown in SEQ ID NO.1, specifically as :
[0053]tatggcacgtctctcctccttgcgacaccggcaggacaccgggcgcttatggtcggcaagcgacgtccctgtagcaaggcaaaccatcgcttcacgtgagatgctgaaaacgaaagctcatccttctgcactggcgcacgtcgccagaaagtattgttaataaagcgtagtgaaacttttgcacaaaacaatacaaactgtgtggatttatcttttagcgataaaaatggacctatttttcttttggccgggcggtggggatgtttagccggttgctaaacgagtaaaagagaaggaattcggatcctagagggaaaccgttgtggtctccctatagtgagtcgtattaatttcgcgggatcgagatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcagcgccc...
Embodiment 3
[0101] Example 3 Schematic diagram of E. coli S17-3 high-density growth over time
[0102] Shake flask fermentation of the recombinant Escherichia coli BW25113 / pETACAB, BW25113 / pBhya-CAB, S17-3 / pETACAB, S17-3 / pBhya-CAB obtained by electroporation in Example 2: pick Escherichia coli S17-3 with an inoculation loop / pBhya-CAB was inoculated into a test tube filled with 3ml LB, cultured overnight at 37°C on a shaker at 200r / min. Inoculate overnight cultured E. coli into a 500mL shake flask containing 100mL liquid LB medium at an inoculum size of 1%, add 20g / L glucose and 100ul of 100ug / ml ampicillin antibiotics to the medium, and also incubate at 37°C , 200r / min shaker for fermentation. The initial pH of the medium was controlled at around pH 7.0. Fermentation 24h sampling measurement cell growth density OD 600 . figure 2 The cell density OD was obtained by fermenting four strains of recombinant Escherichia coli for 24 hours. 600 . from figure 2 It can be observed that th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


